- Key Differences
Know the Differences & Comparisons
![](http://ortec.site/777/templates/cheerup1/res/banner1.gif)
Difference Between Essay and Report
![essay and report similarities essay vs report](https://keydifferences.com/wp-content/uploads/2020/02/essay-vs-report1.jpg)
On the other hand, an essay can be understood as a piece of writing, on a specific topic or subject, which expresses the author’s own ideas and knowledge about the subject.
The basic difference between essay and report is that while an essay is argumentative and idea-based, reports are informative and fact-based. Now, let us move further to understand some more points of differences.
Content: Essay Vs Report
Comparison chart, definition of essay.
An essay can be understood as a comprehensive literary composition, written in a narrative style and presents a particular topic, supports an argument and highlights the writer’s view or ideology. An essay is used to check a person’s outlook and understanding on specific matters and also his/her ability to describe and argue in a way which convinces the reader or informs him/her about a specific topic.
One can make use of learned materials, along with his/her own research, to write an essay effectively. It includes both narrative and subjective thoughts. Further, an essay supports a single idea at a time, for which several components need to be covered in it so as to appear logical and chronological.
It can be a learned argument, observation of day to day life, literary criticism, political manifestos, recollections, and reflections of the writer. It starts with a question and attempts to answer or give suggestions to the problem, on the basis of the existing theories or the writer’s personal opinion and assessment.
While writing an essay, it must be kept in mind that the approach used by the writer should be positive, even if the topic of argument is negative.
Definition of Report
The report implies a well structured factual document which is created and presented after conducting an independent enquiry, research or investigation on a specific subject. It serves as a basis for problem-solving and decision making.
Reports are prepared for a definite purpose and contain relevant information in a proper format, for a particular audience. It is used to identify, observe and analyse the issues, events, findings, that occurred practically, i.e. in real life.
A report is designed with the aim of informing the reader about the event, situation or issue, in a very simple and objective manner, while enabling them to get the desired information quickly and easily. It provides recommendations for future actions. Information collected from research, or from carrying out a project work is presented in a clear and concise manner, under a set of headings and subheadings, that helps the reader to get the desired information quickly and easily.
Characteristics of an Ideal Report
- It must be clear and concise.
- It is written in easy language which the readers can understand easily.
- It has to be appropriate and accurate.
- It should be well drafted and organised, with specific sections, headings and sub-headings.
A report summary can be provided orally, however detailed reports are usually in the form of written documents. It contains – Title Page, Acknowledgement, Authorization Letter, Table of Contents, Executive Summary, Introduction, Discussion, Results, Conclusion, Recommendations and References.
Moreover, Cover letter, Copyright notice, Bibliography, Glossary and Appendices may also form part of a report.
Key Differences Between Essay and Report
The difference Between report and essay is discussed here in detail:
- An essay is a brief literary composition, which is used to describe, present, argue, and analyse the idea or topic. Conversely, a report is a formal and concise document consisting of findings from the practical research. It aims at investigating and exploring the problem under study.
- An essay is written on the basis of subjective analysis of theories and past research, by other people and own ideas, on the concerned subject. As against, a report is objective and factual, which is based on past research, as well as present data and findings.
- An essay talks about general facts and events along with the writer’s personal ideas and views, on the topic in a non-fictional manner. On the contrary, a report contains information which the reader can use to identify the facts or support in decision making or solving issues if any.
- When it comes to sections, a report usually contains different sections, with catchy headings which may attract the attention of the audience. As against, an essay does not have any section, its flow is continuous. However, it is divided into cohesive paragraphs.
- A report uses tables, charts, graphs, diagrams, statistics and many more for a clear and better presentation of the information. But, in the case of essays, they are not used.
- The conclusion in an essay is based on the writer’s personal opinion and views on the topic itself which must be optimistic, and it does not provide any recommendations for future actions. On the other hand, a report gives an independent conclusion, but it may contain the opinion of the experts or previous researchers and recommendations are included, about how the research can be improved and extended.
In a nutshell, Essays are descriptive, subjective and evaluative, whereas, a report is descriptive, objective and analytical. Essays are mainly used in an academic context, whereas reports are preferred in the field of research.
The report is used to present the researched information in a written format, to the audience. Conversely, essays are used to identify what the writer knows about the topic and how well the writer understand the question.
You Might Also Like:
![essay and report similarities theme vs topic](https://keydifferences.com/wp-content/uploads/2019/12/theme-vs-topic-thumbnail-180x75.jpg)
Anna H. Smith says
November 26, 2020 at 3:22 pm
Thank you for explaining this so eloquently. Excellent post, I will keep this handy and refer to it often from now on, the information is so clear and so insightful, thanks for giving a clear difference. It’s a very educative article.!
Presley Dube says
November 20, 2021 at 3:43 pm
very useful to me thank you.
Leonard says
August 8, 2022 at 2:52 pm
Thanks for sharing such nice information about this topic.
Ignatius Phiri says
March 20, 2023 at 10:39 pm
Leave a Reply Cancel reply
Your email address will not be published. Required fields are marked *
Save my name, email, and website in this browser for the next time I comment.
![essay and report similarities University of Portsmouth logo](https://www.port.ac.uk/themes/custom/portsmouth//images/logo-mobile.png)
Reports and essays: key differences
![essay and report similarities Female student looking over project in Eldon Courtyard](https://www.port.ac.uk/sites/default/files/styles/hero_mobile/public/media/images/webimage-CF3613FF-6255-4533-9B2539E65B158F8D.jpg?itok=z_6MNkrl)
Know what to expect
Explore the main differences between reports and essays and how to write for your assignments
You'll complete assignments with different requirements throughout your degree, so it's important to understand what you need to do for each of them. Here we explore the key differences between reports and essays.
This page describes general features of academic reports and essays. Depending on your subject you may use all of these features, a selection of them, or you may have additional requirements.
There is no single right way to write a report or essay, but they are different assignments. At a glance:
- Reports depend heavily on your subject and the type of report.
- Essays usually have specific content and a planned structure with a focus on sense and flow. You subject might need different types of information in your introduction – some disciplines include a short background and context here, while others begin their discussion, discuss their resources or briefly signpost the topic.
Differences between reports and essays
This table compares reports and essays and provides an outline of the standard structure for each. Your assignment will also depend on your discipline, the purpose of your work, and your audience – so you should check what you need to do in your course and module handbooks, instructions from your lecturer, and your subject conventions.
Table adapted from Cottrell, 2003, p. 209.
The structure of reports
Most reports use an IMRaD structure: Introduction, Methods, Results and Discussion.
Below are some common sections that also appear in reports. Some sections include alternative headings.
1. Table of contents
Your contents shows the number of each report section, its title, page number and any sub-sections. Sub-section numbers and details start under the section title, not the margin or the number.
2. Abstract or Executive summary
This brief summary of the report is usually the last thing you write.
3. Introduction
Your introduction describes the purpose of the report, explains why it necessary or useful, and sets out its precise aims and objectives.
4. Literature review
This describes current research and thinking about the problem or research question, and is often incorporated into the introduction.
5. Methods or Methodology
This describes and justifies the methods or processes used to collect your data.
6. Results or Findings
This section presents the results (or processed data) from the research and may consist of mainly tables, charts and or diagrams.
7. Discussion, or Analysis, or Interpretation
This section analyses the results and evaluates the research carried out.
8. Conclusion
The conclusion summarises the report and usually revisits the aims and objectives.
9. Recommendations
In this section the writer uses the results and conclusions from the report to make practical suggestions about a problem or issue. This may not be required.
10. Appendices
You can include raw data or materials that your report refers to in the appendix, if you need to. The data is often presented as charts, diagrams and tables. Each item should be numbered : for example, write Table 1 and its title; Table 2 and its title, and so on as needed.
Structure of essays
Introduction.
Your essay introduction contextualises and gives background information about the topic or questions being discussed, and sets out what the essay is going to cover.
Your essay body is divided into paragraphs. These paragraphs help make a continuous, flowing text.
The conclusion summarises the main points made in the essay. Avoid introducing new information in your conclusion.
Bibliography or Reference list
This is a list of the resources you've used in your essay. This is usually presented alphabetically by authors’ surname.
Reference for the Table of Distinctions above:
Cottrell, S. (2003). The Study Skills Handbook (2nd ed.). Basingstoke: Palgrave.
Download our report and essay differences revision sheet
Download this page as a PDF for your report and essay revision notes.
![essay and report similarities Smiling student in library in placements meeting](https://www.port.ac.uk/sites/default/files/styles/card_mobile/public/media/images/webimage-3446E05B-55CA-4CF0-B05665C496BECEA4.jpg?itok=fO2H6OtG)
Key features of academic reports
![essay and report similarities Postgrad students taking notes and planning essay](https://www.port.ac.uk/sites/default/files/styles/card_mobile/public/media/images/students-planning-essay-1200x400.jpeg?h=8e3006ae&itok=Z7S97Oyl)
Basic essay structure
![essay and report similarities CCI Facilities; June 2019](https://www.port.ac.uk/sites/default/files/styles/card_mobile/public/media/images/webimage-74BF4134-C8EF-4CD4-AF2C55DF81B1F3B8.jpg?itok=Bs9TnZ03)
Writing clear sentences
Find an undergraduate or postgraduate degree course that suits you at Portsmouth.
![essay and report similarities Woman using a DSLR camera in a photo studio with man](https://www.port.ac.uk/sites/default/files/styles/card_mobile/public/media/images/webimage-BCFF34B9-0912-4681-8D47C3DC43E66570.jpg?itok=xejQmwgo)
Guidance and support
Find out about the guidance and support you'll get if you need a helping hand with academic life – or life in general – when you study with us at Portsmouth.
![essay and report similarities Student and guidance counsellor discussing support, and eating cake](https://www.port.ac.uk/sites/default/files/styles/card_mobile/public/media/images/undergraduate-guidance-and-support.jpg?h=c538bde5&itok=jtcg4Z9V)
![essay and report similarities The Writing Center • University of North Carolina at Chapel Hill](https://writingcenter.unc.edu/wp-content/uploads/sites/346/2018/08/writingcenterlogo-oneline.png)
Comparing and Contrasting
What this handout is about.
This handout will help you first to determine whether a particular assignment is asking for comparison/contrast and then to generate a list of similarities and differences, decide which similarities and differences to focus on, and organize your paper so that it will be clear and effective. It will also explain how you can (and why you should) develop a thesis that goes beyond “Thing A and Thing B are similar in many ways but different in others.”
Introduction
In your career as a student, you’ll encounter many different kinds of writing assignments, each with its own requirements. One of the most common is the comparison/contrast essay, in which you focus on the ways in which certain things or ideas—usually two of them—are similar to (this is the comparison) and/or different from (this is the contrast) one another. By assigning such essays, your instructors are encouraging you to make connections between texts or ideas, engage in critical thinking, and go beyond mere description or summary to generate interesting analysis: when you reflect on similarities and differences, you gain a deeper understanding of the items you are comparing, their relationship to each other, and what is most important about them.
Recognizing comparison/contrast in assignments
Some assignments use words—like compare, contrast, similarities, and differences—that make it easy for you to see that they are asking you to compare and/or contrast. Here are a few hypothetical examples:
- Compare and contrast Frye’s and Bartky’s accounts of oppression.
- Compare WWI to WWII, identifying similarities in the causes, development, and outcomes of the wars.
- Contrast Wordsworth and Coleridge; what are the major differences in their poetry?
Notice that some topics ask only for comparison, others only for contrast, and others for both.
But it’s not always so easy to tell whether an assignment is asking you to include comparison/contrast. And in some cases, comparison/contrast is only part of the essay—you begin by comparing and/or contrasting two or more things and then use what you’ve learned to construct an argument or evaluation. Consider these examples, noticing the language that is used to ask for the comparison/contrast and whether the comparison/contrast is only one part of a larger assignment:
- Choose a particular idea or theme, such as romantic love, death, or nature, and consider how it is treated in two Romantic poems.
- How do the different authors we have studied so far define and describe oppression?
- Compare Frye’s and Bartky’s accounts of oppression. What does each imply about women’s collusion in their own oppression? Which is more accurate?
- In the texts we’ve studied, soldiers who served in different wars offer differing accounts of their experiences and feelings both during and after the fighting. What commonalities are there in these accounts? What factors do you think are responsible for their differences?
You may want to check out our handout on understanding assignments for additional tips.
Using comparison/contrast for all kinds of writing projects
Sometimes you may want to use comparison/contrast techniques in your own pre-writing work to get ideas that you can later use for an argument, even if comparison/contrast isn’t an official requirement for the paper you’re writing. For example, if you wanted to argue that Frye’s account of oppression is better than both de Beauvoir’s and Bartky’s, comparing and contrasting the main arguments of those three authors might help you construct your evaluation—even though the topic may not have asked for comparison/contrast and the lists of similarities and differences you generate may not appear anywhere in the final draft of your paper.
Discovering similarities and differences
Making a Venn diagram or a chart can help you quickly and efficiently compare and contrast two or more things or ideas. To make a Venn diagram, simply draw some overlapping circles, one circle for each item you’re considering. In the central area where they overlap, list the traits the two items have in common. Assign each one of the areas that doesn’t overlap; in those areas, you can list the traits that make the things different. Here’s a very simple example, using two pizza places:
![Venn Venn diagram indicating that both Pepper's and Amante serve pizza with unusual ingredients at moderate prices, despite differences in location, wait times, and delivery options](https://writingcenter.unc.edu/wp-content/uploads/sites/346/2019/02/ComparingContrastingDiagram.png)
To make a chart, figure out what criteria you want to focus on in comparing the items. Along the left side of the page, list each of the criteria. Across the top, list the names of the items. You should then have a box per item for each criterion; you can fill the boxes in and then survey what you’ve discovered.
Here’s an example, this time using three pizza places:
As you generate points of comparison, consider the purpose and content of the assignment and the focus of the class. What do you think the professor wants you to learn by doing this comparison/contrast? How does it fit with what you have been studying so far and with the other assignments in the course? Are there any clues about what to focus on in the assignment itself?
Here are some general questions about different types of things you might have to compare. These are by no means complete or definitive lists; they’re just here to give you some ideas—you can generate your own questions for these and other types of comparison. You may want to begin by using the questions reporters traditionally ask: Who? What? Where? When? Why? How? If you’re talking about objects, you might also consider general properties like size, shape, color, sound, weight, taste, texture, smell, number, duration, and location.
Two historical periods or events
- When did they occur—do you know the date(s) and duration? What happened or changed during each? Why are they significant?
- What kinds of work did people do? What kinds of relationships did they have? What did they value?
- What kinds of governments were there? Who were important people involved?
- What caused events in these periods, and what consequences did they have later on?
Two ideas or theories
- What are they about?
- Did they originate at some particular time?
- Who created them? Who uses or defends them?
- What is the central focus, claim, or goal of each? What conclusions do they offer?
- How are they applied to situations/people/things/etc.?
- Which seems more plausible to you, and why? How broad is their scope?
- What kind of evidence is usually offered for them?
Two pieces of writing or art
- What are their titles? What do they describe or depict?
- What is their tone or mood? What is their form?
- Who created them? When were they created? Why do you think they were created as they were? What themes do they address?
- Do you think one is of higher quality or greater merit than the other(s)—and if so, why?
- For writing: what plot, characterization, setting, theme, tone, and type of narration are used?
- Where are they from? How old are they? What is the gender, race, class, etc. of each?
- What, if anything, are they known for? Do they have any relationship to each other?
- What are they like? What did/do they do? What do they believe? Why are they interesting?
- What stands out most about each of them?
Deciding what to focus on
By now you have probably generated a huge list of similarities and differences—congratulations! Next you must decide which of them are interesting, important, and relevant enough to be included in your paper. Ask yourself these questions:
- What’s relevant to the assignment?
- What’s relevant to the course?
- What’s interesting and informative?
- What matters to the argument you are going to make?
- What’s basic or central (and needs to be mentioned even if obvious)?
- Overall, what’s more important—the similarities or the differences?
Suppose that you are writing a paper comparing two novels. For most literature classes, the fact that they both use Caslon type (a kind of typeface, like the fonts you may use in your writing) is not going to be relevant, nor is the fact that one of them has a few illustrations and the other has none; literature classes are more likely to focus on subjects like characterization, plot, setting, the writer’s style and intentions, language, central themes, and so forth. However, if you were writing a paper for a class on typesetting or on how illustrations are used to enhance novels, the typeface and presence or absence of illustrations might be absolutely critical to include in your final paper.
Sometimes a particular point of comparison or contrast might be relevant but not terribly revealing or interesting. For example, if you are writing a paper about Wordsworth’s “Tintern Abbey” and Coleridge’s “Frost at Midnight,” pointing out that they both have nature as a central theme is relevant (comparisons of poetry often talk about themes) but not terribly interesting; your class has probably already had many discussions about the Romantic poets’ fondness for nature. Talking about the different ways nature is depicted or the different aspects of nature that are emphasized might be more interesting and show a more sophisticated understanding of the poems.
Your thesis
The thesis of your comparison/contrast paper is very important: it can help you create a focused argument and give your reader a road map so they don’t get lost in the sea of points you are about to make. As in any paper, you will want to replace vague reports of your general topic (for example, “This paper will compare and contrast two pizza places,” or “Pepper’s and Amante are similar in some ways and different in others,” or “Pepper’s and Amante are similar in many ways, but they have one major difference”) with something more detailed and specific. For example, you might say, “Pepper’s and Amante have similar prices and ingredients, but their atmospheres and willingness to deliver set them apart.”
Be careful, though—although this thesis is fairly specific and does propose a simple argument (that atmosphere and delivery make the two pizza places different), your instructor will often be looking for a bit more analysis. In this case, the obvious question is “So what? Why should anyone care that Pepper’s and Amante are different in this way?” One might also wonder why the writer chose those two particular pizza places to compare—why not Papa John’s, Dominos, or Pizza Hut? Again, thinking about the context the class provides may help you answer such questions and make a stronger argument. Here’s a revision of the thesis mentioned earlier:
Pepper’s and Amante both offer a greater variety of ingredients than other Chapel Hill/Carrboro pizza places (and than any of the national chains), but the funky, lively atmosphere at Pepper’s makes it a better place to give visiting friends and family a taste of local culture.
You may find our handout on constructing thesis statements useful at this stage.
Organizing your paper
There are many different ways to organize a comparison/contrast essay. Here are two:
Subject-by-subject
Begin by saying everything you have to say about the first subject you are discussing, then move on and make all the points you want to make about the second subject (and after that, the third, and so on, if you’re comparing/contrasting more than two things). If the paper is short, you might be able to fit all of your points about each item into a single paragraph, but it’s more likely that you’d have several paragraphs per item. Using our pizza place comparison/contrast as an example, after the introduction, you might have a paragraph about the ingredients available at Pepper’s, a paragraph about its location, and a paragraph about its ambience. Then you’d have three similar paragraphs about Amante, followed by your conclusion.
The danger of this subject-by-subject organization is that your paper will simply be a list of points: a certain number of points (in my example, three) about one subject, then a certain number of points about another. This is usually not what college instructors are looking for in a paper—generally they want you to compare or contrast two or more things very directly, rather than just listing the traits the things have and leaving it up to the reader to reflect on how those traits are similar or different and why those similarities or differences matter. Thus, if you use the subject-by-subject form, you will probably want to have a very strong, analytical thesis and at least one body paragraph that ties all of your different points together.
A subject-by-subject structure can be a logical choice if you are writing what is sometimes called a “lens” comparison, in which you use one subject or item (which isn’t really your main topic) to better understand another item (which is). For example, you might be asked to compare a poem you’ve already covered thoroughly in class with one you are reading on your own. It might make sense to give a brief summary of your main ideas about the first poem (this would be your first subject, the “lens”), and then spend most of your paper discussing how those points are similar to or different from your ideas about the second.
Point-by-point
Rather than addressing things one subject at a time, you may wish to talk about one point of comparison at a time. There are two main ways this might play out, depending on how much you have to say about each of the things you are comparing. If you have just a little, you might, in a single paragraph, discuss how a certain point of comparison/contrast relates to all the items you are discussing. For example, I might describe, in one paragraph, what the prices are like at both Pepper’s and Amante; in the next paragraph, I might compare the ingredients available; in a third, I might contrast the atmospheres of the two restaurants.
If I had a bit more to say about the items I was comparing/contrasting, I might devote a whole paragraph to how each point relates to each item. For example, I might have a whole paragraph about the clientele at Pepper’s, followed by a whole paragraph about the clientele at Amante; then I would move on and do two more paragraphs discussing my next point of comparison/contrast—like the ingredients available at each restaurant.
There are no hard and fast rules about organizing a comparison/contrast paper, of course. Just be sure that your reader can easily tell what’s going on! Be aware, too, of the placement of your different points. If you are writing a comparison/contrast in service of an argument, keep in mind that the last point you make is the one you are leaving your reader with. For example, if I am trying to argue that Amante is better than Pepper’s, I should end with a contrast that leaves Amante sounding good, rather than with a point of comparison that I have to admit makes Pepper’s look better. If you’ve decided that the differences between the items you’re comparing/contrasting are most important, you’ll want to end with the differences—and vice versa, if the similarities seem most important to you.
Our handout on organization can help you write good topic sentences and transitions and make sure that you have a good overall structure in place for your paper.
Cue words and other tips
To help your reader keep track of where you are in the comparison/contrast, you’ll want to be sure that your transitions and topic sentences are especially strong. Your thesis should already have given the reader an idea of the points you’ll be making and the organization you’ll be using, but you can help them out with some extra cues. The following words may be helpful to you in signaling your intentions:
- like, similar to, also, unlike, similarly, in the same way, likewise, again, compared to, in contrast, in like manner, contrasted with, on the contrary, however, although, yet, even though, still, but, nevertheless, conversely, at the same time, regardless, despite, while, on the one hand … on the other hand.
For example, you might have a topic sentence like one of these:
- Compared to Pepper’s, Amante is quiet.
- Like Amante, Pepper’s offers fresh garlic as a topping.
- Despite their different locations (downtown Chapel Hill and downtown Carrboro), Pepper’s and Amante are both fairly easy to get to.
You may reproduce it for non-commercial use if you use the entire handout and attribute the source: The Writing Center, University of North Carolina at Chapel Hill
Make a Gift
Core Differences
We Provide Comparison for All Terms
10 Difference between Essay and Report (With Table)
What is the main difference between essay and report? An essay pertains to a literary technique wherein nearly all aspects of a subject are thoroughly explored or articulated. A report serve as the documentation and comprehensive analysis of the discoveries and suggestions derived from practical research.
In the realm of academic writing, students frequently come across two prevalent types of assignments: essays and reports. While these assignments share certain resemblances, they also possess marked distinctions.
This piece aims to delve into the contrasting characteristics of essays and reports, with a particular emphasis on their objectives, structures, and writing approaches.
Difference between Essay and Report with Table
What is essay.
An essay is a written composition that presents a focused and organized discussion or exploration of a particular topic, idea, or argument. Essays are a common form of academic, literary, and creative writing and are characterized by several key features:
Thesis Statement : An essay typically begins with a clear and concise thesis statement that outlines the main argument or purpose of the essay.
Structure : Essays follow a specific structure, including an introduction, body paragraphs, and a conclusion. This structure allows for the logical presentation of ideas and arguments.
Supporting Evidence : Arguments and claims in an essay are supported by evidence, which may include examples, data, quotes, or references to authoritative sources.
Coherence : Essays are expected to be coherent, with ideas flowing logically from one point to the next. Transitions and topic sentences help maintain this coherence.
Analysis : Essays often involve critical thinking and analysis, where the writer evaluates, interprets, or critiques the topic or subject matter.
Clarity and Conciseness : Effective essays are clear, concise, and free from unnecessary jargon or verbosity. They communicate ideas effectively to the intended audience.
Variety of Types : Essays come in various forms, such as argumentative, persuasive, expository, narrative, and descriptive, each with its own unique characteristics and objectives.
What Is Report?
A report is a formal and structured document that presents information, data, findings, or recommendations on a specific topic, issue, or problem. Reports are typically written for a targeted audience, such as business professionals, government officials, researchers, or stakeholders, and they serve various purposes:
Information Dissemination : Reports convey objective and factual information, often gathered through research, investigation, or analysis.
Problem-Solving : Some reports are designed to address specific problems or challenges, offering solutions or recommendations.
Decision-Making : Reports provide the necessary data and analysis to support informed decision-making processes.
Documentation : They serve as records of events, actions, or research, preserving information for future reference.
Accountability : Reports may be used to document the performance or progress of projects, organizations, or individuals, ensuring accountability.
Main Difference between Essay and Report
- An essay serves as a concise literary composition for presenting and analyzing ideas, while a report is a formal document that communicates research findings.
- Essays blend subjective analysis with personal ideas, while reports maintain objectivity by relying on past research and current data.
- Essays incorporate general facts and the writer’s opinions in a non-fictional manner. Conversely, reports offer information that aids in identifying facts or supports decision-making and problem-solving.
- Reports are structured with sections featuring engaging headings, while essays follow a continuous flow but are divided into coherent paragraphs.
- Reports use visuals like tables, charts, graphs, and statistics for clarity, whereas essays typically do not include such elements.
- Essay conclusions reflect the writer’s personal opinions and tend to be optimistic, lacking recommendations for future actions. Reports provide impartial conclusions, potentially including expert opinions and recommendations for further research and improvement.
Similarities between Essay and Report
- Both are written documents.
- They require clear and coherent writing.
- Proper grammar, punctuation, and style are essential in both.
- Both may require citations and references.
- They serve as means of conveying information or ideas.
- Both should have a well-organized structure.
- An introduction and conclusion are common elements in both.
In conclusion, while essays and reports are both written forms of communication, they serve distinct purposes and exhibit notable differences in their characteristics and structures.
Essays are primarily vehicles for presenting, analyzing, and discussing ideas or viewpoints, often incorporating subjective analysis and personal opinions.
In contrast, reports are formal documents intended to convey objective information, research findings, or recommendations, maintaining objectivity and utilizing data and past research.
The structural variances are evident, with essays featuring a continuous flow of text divided into paragraphs, while reports are organized into sections with informative headings for clarity. Additionally, reports often employ visual aids like charts and tables, enhancing data presentation.
Finally, their conclusions differ significantly, as essays express personal opinions and optimism, while reports provide impartial conclusions with recommendations for further research or action.
People Who Read This Also Read:
- Difference between Abstract and Introduction
- Difference between Commercial Bank and Merchant Bank
- Difference between EFT and ACH
- Difference between Copyright Infringement and Plagiarism
Leave a Comment Cancel reply
Save my name, email, and website in this browser for the next time I comment.
Library Guides
![essay and report similarities decorative image](https://libapps-eu.s3.amazonaws.com/customers/2218/images/UoG-gradient-logo.jpg)
Academic Support
- Code of Practice
- Get Academic Support
The purpose of an essay
When we write an essay we are often looking at topics in depth. The essay may voice an opinion, or explain something in detail. The essay may include arguments or counter arguments or offer solutions to problems.Tthere are many different ways to approach writing an essay. The purpose of an essay is to provide a detailed insight in to an aspect of a topic.
The purpose of a report
A report often discusses the results of a practical investigation. For example a report could discuss an experiment and its results or discuss research that has been undertaken. The purpose of a report is to help people to find the information they need quickly . For example they may need to see the results of an experiment but not want to know how it was carried out.
The common structure of an essay
An essay has the following structure: introduction, main body of the essay and conclusion. Each part of the essay is written in paragraphs. It is not common practice to use headings within an essay. The paragraphs within the essay should link together clearly as the reader is going to be reading every section. This can be done by trying to link each paragraph to the other.
The common structure of a report
Reports often include the following features:
A list of contents - this shows your reader where they can find the exact information they are looking for.
An abstract - an abstract is a brief summary of the report journal article or research. It usually outlines its purpose, methodology and findings ( results)
An introduction - h ere you say what you are going to be discussing in the report and why the report is important .
A literature review - this shows what you have read before completing your report.
Methodology - this explains what you did and how you did it
The results - here you present your findings
Discussion - i n this section you discuss your results.
Conclusions - here you say what the report has shown and what you think could be learnt from the report.
Recommendations - often a report will include your recommendations - what you think should be done next having considered the results.
The main differences between a report and an essay
Reports are divided into many sections whereas essays have three main sections divided into paragraphs.
Reports include an abstract, essays do not.
Reports can use bullet points, essays do not.
Reports can use subheadings for each of the sections, it is rare for essays to have subheadings.
Reports often include graphs and tables , essays do not.
Similarities between report writing and essay writing
Both use a formal style- this means that we don't use shortened words, we remember we are writing for an academic audience, we don't use slang, and we write in sentences, using a formal style.
Both avoid sounding personal - in academic writing it is important to sound objective . This means that you don't try to sway your reader with your own opinions and viewpoints but you put your points across using proof and evidence. With this in mind, in reports and essay writing personal pronouns (Example: I) should be avoided.
Both need to be clear- whatever you are writing it is important that you make your writing clear. In both reports and essays an introduction will be included to show the purpose of the piece of work, and a conclusion to sum up the key points. The main body of both texts should be written in a logical well ordered way.
- Last Updated: Apr 25, 2024 1:19 PM
- URL: https://libguides.gre.ac.uk/academicskills
Library policies | Library Code of Conduct | IT Service Status | Portal © University of Greenwich | FOI | Privacy and cookies | Legal | Terms & conditions
![essay and report similarities essay and report similarities](https://www.gcu.ac.uk/__data/assets/image/0020/63470/varieties/large.jpg)
Glasgow School for Business and Society
The Glasgow School for Business and Society integrates the areas of business, law and social sciences to ensure that they are well placed to meet the needs of business and society. The School has an international outlook and is committed to developing partnerships across the world.
How does an essay differ from a report?
Essays and reports differ in terms of layout and focus
Essays traditionally, don’t have headings; instead writers develop and sustain an extended argument throughout the text, moving from logically connected paragraphs to create a text that makes sense to the reader. Nowadays it is fairly common for students to use headings and sub-headings in essays if it makes sense to do so. However, your lecturer may have a layout preference for essays without headings, so if you're not sure check with your lecturer or module handbook.
Reports are divided into sections with headings and sub-headings so that the reader can find specific information easily. Business reports often present information visually using graphs, tables and diagrams. Your module handbook will often give you a structure to follow.
An essay tends to focus on concepts, issues and/or theory. The focus of a report is more concrete: the report looks at an issue in a real-world context. Essays, especially business essays, often use real-world examples to illustrate a concept or theory but a conceptual, or abstract, idea is the focus. Business reports often focus on a case study organisation and draw on relevant literature to understand the company.
However essays and reports are similar in many ways. They both:
- Require critical reading of relevant literature
- Integrate ideas from the literature into the text
- Demonstrate critical analysis
- Have a clear structure, written in paragraphs
- Are written in an academic style
- Cite and reference sources using Harvard
- Writing Home
- Writing Advice Home
The Comparative Essay
- Printable PDF Version
- Fair-Use Policy
What is a comparative essay?
A comparative essay asks that you compare at least two (possibly more) items. These items will differ depending on the assignment. You might be asked to compare
- positions on an issue (e.g., responses to midwifery in Canada and the United States)
- theories (e.g., capitalism and communism)
- figures (e.g., GDP in the United States and Britain)
- texts (e.g., Shakespeare’s Hamlet and Macbeth )
- events (e.g., the Great Depression and the global financial crisis of 2008–9)
Although the assignment may say “compare,” the assumption is that you will consider both the similarities and differences; in other words, you will compare and contrast.
Make sure you know the basis for comparison
The assignment sheet may say exactly what you need to compare, or it may ask you to come up with a basis for comparison yourself.
- Provided by the essay question: The essay question may ask that you consider the figure of the gentleman in Charles Dickens’s Great Expectations and Anne Brontë’s The Tenant of Wildfell Hall . The basis for comparison will be the figure of the gentleman.
- Developed by you: The question may simply ask that you compare the two novels. If so, you will need to develop a basis for comparison, that is, a theme, concern, or device common to both works from which you can draw similarities and differences.
Develop a list of similarities and differences
Once you know your basis for comparison, think critically about the similarities and differences between the items you are comparing, and compile a list of them.
For example, you might decide that in Great Expectations , being a true gentleman is not a matter of manners or position but morality, whereas in The Tenant of Wildfell Hall , being a true gentleman is not about luxury and self-indulgence but hard work and productivity.
The list you have generated is not yet your outline for the essay, but it should provide you with enough similarities and differences to construct an initial plan.
Develop a thesis based on the relative weight of similarities and differences
Once you have listed similarities and differences, decide whether the similarities on the whole outweigh the differences or vice versa. Create a thesis statement that reflects their relative weights. A more complex thesis will usually include both similarities and differences. Here are examples of the two main cases:
While Callaghan’s “All the Years of Her Life” and Mistry’s “Of White Hairs and Cricket” both follow the conventions of the coming-of-age narrative, Callaghan’s story adheres more closely to these conventions by allowing its central protagonist to mature. In Mistry’s story, by contrast, no real growth occurs.
Although Darwin and Lamarck came to different conclusions about whether acquired traits can be inherited, they shared the key distinction of recognizing that species evolve over time.
Come up with a structure for your essay
Note that the French and Russian revolutions (A and B) may be dissimilar rather than similar in the way they affected innovation in any of the three areas of technology, military strategy, and administration. To use the alternating method, you just need to have something noteworthy to say about both A and B in each area. Finally, you may certainly include more than three pairs of alternating points: allow the subject matter to determine the number of points you choose to develop in the body of your essay.
When do I use the block method? The block method is particularly useful in the following cases:
- You are unable to find points about A and B that are closely related to each other.
- Your ideas about B build upon or extend your ideas about A.
- You are comparing three or more subjects as opposed to the traditional two.
- Features for Creative Writers
- Features for Work
- Features for Higher Education
- Features for Teachers
- Features for Non-Native Speakers
- Learn Blog Grammar Guide Community Events FAQ
- Grammar Guide
Comparing and Contrasting: A Guide to Improve Your Essays
![essay and report similarities Walter Akolo](https://assets.prowritingaid.com/f/145420/621x500/8645b4032b/headshot-writer-walter-akolo.jpg/m/)
Walter Akolo
![essay and report similarities Comparing and contrasting in essays](https://marketing.prowritingaid.com/Comparing-and-contrasting-title.png)
Essays that require you to compare and contrast two or more subjects, ideas, places, or items are common.
They call for you to highlight the key similarities (compare) and differences (contrast) between them.
This guide contains all the information you need to become better at writing comparing and contrasting essays.
This includes: how to structure your essay, how to decide on the content, and some examples of essay questions.
Let’s dive in.
![essay and report similarities Compare and contrast definition](https://marketing.prowritingaid.com/compare-and-contrast-definition.png)
What Is Comparing and Contrasting?
Is compare and contrast the same as similarities and differences, what is the purpose of comparing and contrasting, can you compare and contrast any two items, how do you compare and contrast in writing, what are some comparing and contrasting techniques, how do you compare and contrast in college level writing, the four essentials of compare and contrast essays, what can you learn from a compare and contrast essay.
At their most basic, both comparing and contrasting base their evaluation on two or more subjects that share a connection.
The subjects could have similar characteristics, features, or foundations.
But while a comparison discusses the similarities of the two subjects, e.g. a banana and a watermelon are both fruit, contrasting highlights how the subjects or items differ from each other, e.g. a watermelon is around 10 times larger than a banana.
Any question that you are asked in education will have a variety of interesting comparisons and deductions that you can make.
Compare is the same as similarities.
Contrast is the same as differences.
This is because comparing identifies the likeness between two subjects, items, or categories, while contrasting recognizes disparities between them.
When you compare things, you represent them regarding their similarity, but when you contrast things, you define them in reference to their differences.
As a result, if you are asked to discuss the similarities and differences between two subjects, you can take an identical approach to if you are writing a compare and contrast essay.
In writing, the purpose of comparing and contrasting is to highlight subtle but important differences or similarities that might not be immediately obvious.
![essay and report similarities The purpose of comparing and contrasting](https://marketing.prowritingaid.com/Purpose-of-comparin-and-contrasting.png)
By illustrating the differences between elements in a similar category, you help heighten readers’ understanding of the subject or topic of discussion.
For instance, you might choose to compare and contrast red wine and white wine by pointing out the subtle differences. One of these differences is that red wine is best served at room temperature while white is best served chilled.
Also, comparing and contrasting helps to make abstract ideas more definite and minimizes the confusion that might exist between two related concepts.
Can Comparing and Contrasting Be Useful Outside of Academia?
Comparing enables you to see the pros and cons, allowing you to have a better understanding of the things under discussion. In an essay, this helps you demonstrate that you understand the nuances of your topic enough to draw meaningful conclusions from them.
Let's use a real-word example to see the benefits. Imagine you're contrasting two dresses you could buy. You might think:
- Dress A is purple, my favorite color, but it has a difficult zip and is practically impossible to match a jacket to.
- Dress B is more expensive but I already have a suitable pair of shoes and jacket and it is easier to move in.
You're linking the qualities of each dress to the context of the decision you're making. This is the same for your essay. Your comparison and contrast points will be in relation to the question you need to answer.
Comparing and contrasting is only a useful technique when applied to two related concepts.
To effectively compare two or more things, they must feature characteristics similar enough to warrant comparison.
In addition to this they must also feature a similarity that generates an interesting discussion. But what do I mean by “interesting” here?
Let’s look at two concepts, the Magna Carta and my third grade poetry competition entry.
They are both text, written on paper by a person so they fulfil the first requirement, they have a similarity. But this comparison clearly would not fulfil the second requirement, you would not be able to draw any interesting conclusions.
However, if we compare the Magna Carta to the Bill of Rights, you would be able to come to some very interesting conclusions concerning the history of world politics.
To write a good compare and contrast essay, it’s best to pick two or more topics that share a meaningful connection .
The aim of the essay would be to show the subtle differences or unforeseen similarities.
By highlighting the distinctions between elements in a similar category you can increase your readers’ understanding.
Alternatively, you could choose to focus on a comparison between two subjects that initially appear unrelated.
The more dissimilar they seem, the more interesting the comparison essay will turn out.
For instance, you could compare and contrast professional rugby players with marathon runners.
Can You Compare and Contrast in an Essay That Does Not Specifically Require It?
As a writer, you can employ comparing and contrasting techniques in your writing, particularly when looking for ideas you can later apply in your argument.
You can do this even when the comparison or contrast is not a requirement for the topic or argument you are presenting. Doing so could enable you to build your evaluation and develop a stronger argument.
Note that the similarities and differences you come up with might not even show up in the final draft.
While the use of compare and contrast can be neutral, you can also use it to highlight one option under discussion. When used this way, you can influence the perceived advantages of your preferred option.
As a writing style, comparing and contrasting can encompass an entire essay. However, it could also appear in some select paragraphs within the essay, where making some comparisons serves to better illustrate a point.
What Should You Do First?
Before you compare two things, always start by deciding on the reason for your comparison, then outline the criteria you will use to compare them.
Words and phrases commonly used for comparison include:
![essay and report similarities Comparison words and phrases](https://marketing.prowritingaid.com/comparison-words-and-phrases.png)
In writing, these words and phrases are called transitions . They help readers to understand or make the connection between sentences, paragraphs, and ideas.
Without transition words writing can feel clumsy and disjointed making it difficult to read. ProWritingAid’s transition report highlights all of a documents transitions and suggests that 25% of any sentences in a piece include a transition.
![essay and report similarities ProWritingAid's Transition Report](https://marketing.prowritingaid.com/PWA-Transition-Report1.png)
Sign up for a free ProWritingAid account to use the Transitions Report.
So, how do you form all of this into a coherent essay? It's a good idea to plan first, then decide what your paragraph layout will look like.
Venn diagrams are useful tool to start generating ideas. The, for your essay, you need to choose between going idea by idea and going point by point.
Using a Venn Diagram
A Venn diagram helps you to clearly see the similarities and differences between multiple objects, things, or subjects.
The writing tool comprises two, or more, simple, overlapping circles in which you list down the things that are alike (within the overlapping area) and those that differ (outside the overlapping area).
It’s great for brainstorming ideas and for creating your essay’s outline. You could even use it in an exam setting because it is quick and simple.
Going Subject by Subject
Going subject by subject is a structural choice for your essay.
Start by saying all you have to say on the first subject, then proceed to do the same about the second subject.
Depending on the length of your essay, you can fit the points about each subject into one paragraph or have several sections per each subject, ending with a conclusion.
This method is best for short essays on simple topics. Most university-level essays will go point by point instead.
Going Point by Point
Going point by point, or alternating, is the opposite essay structure from going subject by subject. This is ideal when you want to do more direct comparing and contrasting. It entails discussing one comparison point at a time. It allows you to use a paragraph to talk about how a certain comparing/contrasting point relates to the subjects or items you are discussing.
Alternatively, if you have lots of details about the subject, you might decide to use a paragraph for each point.
![essay and report similarities Different ways to compare and contrast](https://marketing.prowritingaid.com/Ways-to-compare-and-contrast.png)
An academic compare and contrast essay looks at two or more subjects, ideas, people, or objects, compares their likeness, and contrasts their differences.
It’s an informative essay that provides insights on what is similar and different between the two items.
Depending on the essay’s instructions, you can focus solely on comparing or contrasting, or a combination of the two.
Examples of College Level Compare and Contrast Essay Questions
Here are eleven examples of compare and contrast essay questions that you might encounter at university:
![essay and report similarities Compare and contrast examples](https://marketing.prowritingaid.com/compare-and-contrast-planets.png)
- Archaeology: Compare and contrast the skulls of homo habilis, homo erectus, and homo sapiens.
- Art: Compare and contrast the working styles of any two Neoclassic artists.
- Astrophysics: Compare and contrast the chemical composition of Venus and Neptune.
- Biology: Compare and contrast the theories of Lamarck and Darwin.
- Business: Compare and contrast 2 or more business models within the agricultural industry.
- Creative writing: Compare and contrast free indirect discourse with epistolary styles.
- English Literature: Compare and contrast William Wordsworth with Robert Browning.
- Geography: Compare and contrast the benefit of solar panels with the benefit of wind turbines.
- History: Compare and contrast WWI to WWII with specific reference to the causes and outcomes.
- Medicine: Compare and contrast England’s health service with America’s health service.
- Psychology: Compare and contrast the behaviorist theory with the psychodynamic theory.
So, the key takeaways to keep in mind are:
Have a basis for comparison. The two things need to have enough in common to justify a discussion about their similarities and disparities.
Don’t go back and forth when using the block method. The best way to write your essay is to begin with a paragraph discussing all the facets of the first topic. Then, move on to another paragraph and talk through all the aspects of the second subject.
You can use both alternating and blocking techniques. Combining the two approaches is also an option. You can apply the alternating method in some paragraphs, then switch and use the block method. This method will help you offer a much deeper analysis of the subjects.
Have a reason for comparing the two things. Only select the points of comparison that resonate with your purpose.
![essay and report similarities Compare and contrast, key takeaways](https://marketing.prowritingaid.com/Comparison-key-takeaways.png)
Comparing and contrasting are essential analytical skills in academic writing. When your professor issues you with such an essay, their primary goal is to teach you how to:
- Engage in critical thinking
- See and make connections between words or ideas
- Move beyond mere descriptions or summaries to developing interesting analysis
- Get a deeper understanding of the subjects or items under comparison, their key features, and their interrelationships with each other.
![essay and report similarities The benefits of comparing and contrasting](https://marketing.prowritingaid.com/Benefits-of-compare-and-contrast.png)
Ultimately, your essay should enlighten readers by providing useful information.
Want to use ProWritingAid with your classroom? Download this free book now:
![essay and report similarities ProWritingAid Teacher's Manual](https://cdn.prowritingaid.com/website/2.1.7279/images/e-book-page/book-8.png)
ProWritingAid Teacher’s Manual
Editing technology like prowritingaid provides immediate, personalized feedback that will help students to better understand grammar and writing techniques., in this guide , we walk you through exactly how to use prowritingaid in your classroom and give you tools and templates for creating a rigorous, effective independent writing practice with your students..
![essay and report similarities essay and report similarities](https://cdn.prowritingaid.com/website/2.5.48463/images/cms/blog/grammar.png)
Be confident about grammar
Check every email, essay, or story for grammar mistakes. Fix them before you press send.
Walter Akolo is a freelance writer, internet marketer, trainer, and blogger for hire. He loves helping businesses increase their reach and conversion through excellent and engaging content. He has gotten millions of pageviews on his blog, FreelancerKenya, where he mentors writers. Check out his website walterakolo.com.
Get started with ProWritingAid
Drop us a line or let's stay in touch via :
![essay and report similarities essay and report similarities](https://libapps.s3.amazonaws.com/customers/1460/images/walden-logo-universal-navigation.png)
- Walden University
- Faculty Portal
Writing a Paper: Comparing & Contrasting
A compare and contrast paper discusses the similarities and differences between two or more topics. The paper should contain an introduction with a thesis statement, a body where the comparisons and contrasts are discussed, and a conclusion.
Address Both Similarities and Differences
Because this is a compare and contrast paper, both the similarities and differences should be discussed. This will require analysis on your part, as some topics will appear to be quite similar, and you will have to work to find the differing elements.
Make Sure You Have a Clear Thesis Statement
Just like any other essay, a compare and contrast essay needs a thesis statement. The thesis statement should not only tell your reader what you will do, but it should also address the purpose and importance of comparing and contrasting the material.
Use Clear Transitions
Transitions are important in compare and contrast essays, where you will be moving frequently between different topics or perspectives.
- Examples of transitions and phrases for comparisons: as well, similar to, consistent with, likewise, too
- Examples of transitions and phrases for contrasts: on the other hand, however, although, differs, conversely, rather than.
For more information, check out our transitions page.
Structure Your Paper
Consider how you will present the information. You could present all of the similarities first and then present all of the differences. Or you could go point by point and show the similarity and difference of one point, then the similarity and difference for another point, and so on.
Include Analysis
It is tempting to just provide summary for this type of paper, but analysis will show the importance of the comparisons and contrasts. For instance, if you are comparing two articles on the topic of the nursing shortage, help us understand what this will achieve. Did you find consensus between the articles that will support a certain action step for people in the field? Did you find discrepancies between the two that point to the need for further investigation?
Make Analogous Comparisons
When drawing comparisons or making contrasts, be sure you are dealing with similar aspects of each item. To use an old cliché, are you comparing apples to apples?
- Example of poor comparisons: Kubista studied the effects of a later start time on high school students, but Cook used a mixed methods approach. (This example does not compare similar items. It is not a clear contrast because the sentence does not discuss the same element of the articles. It is like comparing apples to oranges.)
- Example of analogous comparisons: Cook used a mixed methods approach, whereas Kubista used only quantitative methods. (Here, methods are clearly being compared, allowing the reader to understand the distinction.
Related Webinar
![essay and report similarities Webinar](https://s3.amazonaws.com/libapps/customers/1460/images/webinars_icon_website.png)
Didn't find what you need? Email us at [email protected] .
- Previous Page: Developing Arguments
- Next Page: Avoiding Logical Fallacies
- Office of Student Disability Services
Walden Resources
Departments.
- Academic Residencies
- Academic Skills
- Career Planning and Development
- Customer Care Team
- Field Experience
- Military Services
- Student Success Advising
- Writing Skills
![](http://ortec.site/777/templates/cheerup1/res/banner1.gif)
Centers and Offices
- Center for Social Change
- Office of Academic Support and Instructional Services
- Office of Degree Acceleration
- Office of Research and Doctoral Services
- Office of Student Affairs
Student Resources
- Doctoral Writing Assessment
- Form & Style Review
- Quick Answers
- ScholarWorks
- SKIL Courses and Workshops
- Walden Bookstore
- Walden Catalog & Student Handbook
- Student Safety/Title IX
- Legal & Consumer Information
- Website Terms and Conditions
- Cookie Policy
- Accessibility
- Accreditation
- State Authorization
- Net Price Calculator
- Contact Walden
Walden University is a member of Adtalem Global Education, Inc. www.adtalem.com Walden University is certified to operate by SCHEV © 2024 Walden University LLC. All rights reserved.
![essay and report similarities Pediaa.Com](https://pediaa.com/wp-content/uploads/2016/12/logo_new.png)
Home » Language » Difference Between Essay and Report
Difference Between Essay and Report
Main difference – essay vs report.
Essay and report writing is an area that confuses many people . Despite having some similarities, they both are written in different styles. Both Essays and Reports must be written in a formal academic style while carefully checking grammar, spelling, and presentations. There are some common features in essay and report writing as both start with an introduction, body with discussions and analysis, and finally conclusions that demonstrate writer’s analytical thinking ability. However, there are some significant differences between Essays and Reports, and writers should be well aware of these differences before starting to write. The main difference between these two types of writings is their purpose ; an essay presents writer’s personal ideas and opinions about a certain topic while a report provides unbiased information about a certain issue.
What is an Essay
Essay is a piece of writing that describes, analyzes and evaluates a certain topic or an issue . An essay generally contains a combination of facts, statistics and writer’s personal view and opinions. An essay can be categorized into various types, depending on the nature of the title and the style of the author. Descriptive, Narrative, Argumentative, Persuasive, and Expository are some of these types of Essays. Though there is no strict format for essay writing, an essay generally includes an introduction, body, and conclusion. Essays are mostly used in the field of Education and are usually about academic subjects.
What are the Different Types of Essays
How to write an essay, what is a report.
A report is a systematic, well-organised document that defines and analyses a certain issue or a problem . The primary aim of a report is to provide information. A report is divided into several sections, headings, and sub-headings. A report is divided into sections in this manner so that anyone can scan the document and find quickly, the specific information he/she needs. Reports are used in different fields, and various types of reports written for different purposes can be found in our day to day life. Reports are generally written for practical purposes. Academic reports, Business reports, Laboratory reports are examples of such reports. Another significant feature that can be observed in a report is that the writer indicates recommendations, solutions to the issue at the end of the report. Graphs, tables, sentences in bullet points can also be used in report writing.
Let us now look at the difference between essay and report separately. One of the main difference between essay and report is the purpose. An essay is written to present writer’s personal ideas and opinions while a report is written to provide information about a certain issue. Another significant difference between essay and report is the format. A report is divided into sections, headings, and sub-headings, but an essay is never divided into sections and headings; it has interconnecting paragraphs. The conclusion of a report is unbiased and recommendations are provided at the end while the conclusion of an essay depends heavily on the opinion of the author. A report contains graphs and tables while an essay rarely contains graphs and tables. An appendix can be attached to the report for further reference. One of the most efficient features of a report, is that the information can be found quickly by scanning the headings and sections but, in an essay, it is difficult to find a specific information without reading the whole essay.
![essay and report similarities Difference Between Report and Essay](https://i0.wp.com/pediaa.com/wp-content/uploads/2015/07/Difference-Between-Report-and-Essay.png?resize=410%2C1024)
About the Author: Hasa
Hasanthi is a seasoned content writer and editor with over 8 years of experience. Armed with a BA degree in English and a knack for digital marketing, she explores her passions for literature, history, culture, and food through her engaging and informative writing.
You May Also Like These
How to Write a Comparison Essay: From Similarities to Differences
![essay and report similarities image](https://papersowl.com/wp-content/uploads/thumb/b5/dd6c4a3a9693bb5_40x40.png)
Table of contents
- 1.1 What Сan I Compare and Contrast?
- 1.2 Choosing a Great Topic for a Comparison Essay
- 1.3 Education Compare and Contrast Essays Topics
- 1.4 Sports Compare and Contrast Essays Topics
- 1.5 Politics Compare and Contrast Essays Topics
- 1.6 Economy Compare and Contrast Essays Topics
- 1.7 Social Studies Compare and Contrast Essays Topics
- 1.8 History Compare and Contrast Essays Topics
- 1.9 Literature Compare and Contrast Essays Topics
- 1.10 Controversial Compare and Contrast Essay Topics
- 2.1 Thesis Statement
- 3.0.1 Understand Your Subjects:
- 3.0.2 Purpose of the Essay:
- 3.0.3 Audience Consideration:
- 3.0.4 Two Predominant Structures:
- 4.1 Comparison Essay Outline Example
- 5.1 Comparison Essay Format
- 6 Bringing It All Together
As we navigate our lives, we can’t help but notice the elements in our environment, whether it’s the latest car, a fashion trend, or even some experiences. Think about your favorite Mexican restaurant, then visit another; automatically, you’re likely to size them up to each other. So when your professors assign you homework to compare two samples in a case study, it may seem natural.
But at the college level, something happens, our natural ability to compare vacates us. You may be stuck wondering how to write a comparison essay. This is a common dilemma many students face. We’ve put together this comprehensive guide to walk you through the perfect paper’s construction steps. Below, you’ll find:
- A comprehensive guide on how to write a comparison essay, outlining its purpose, how to choose relevant topics for comparison, and the structure for presenting the content effectively.
- That the comparison essay requires the writer to analyze two objects, events, or theories and identify their similarities and differences, supporting findings with empirical data.
- For a successful comparison essay, it’s essential to choose relevant subjects, have a clear and precise thesis statement, and employ an effective structure, depending on the subjects and purpose of the essay.
So read on to learn how the pros from Papersowl suggest writing a compare and contrast essay.
What Is a Comparison Essay?
As it sounds, your comparative essay should analyze two objects, events, or theories and determine the similarities and differences . The overall goal of the paper is for the reader to clearly identify how the studied criteria are the same and where they diverge. In a marketing class, you may evaluate two similar products and develop a plan to demonstrate their features and benefits. Or, in a psychology class, you may have an in-depth look at two therapy techniques and then evaluate the results of a particular case study.
Your paper’s critical component is that you must ensure your findings are backed up with empirical data. While you may feel one subject is “better” than another, giving examples to prove your position is important. Information that can be weighed or measured, such as a device’s performance or the results of a process, is strong evidence to support a claim.
What Сan I Compare and Contrast?
As long as the main points make sense and the essay is comprehensive to the reader, anything can be used as a topic for a compare-and-contrast essay. It is important to remember that two principal subjects related in one way should be compared and contrasted. To help you better understand this concept, below is a table serving as a visual aid and showcasing examples of compare and contrast essay topics.
The “Good Examples” column presents two semantic subjects. They are not entirely different and, as such, leave more room for analysis. The column “Examples to improve” also contains subjects relevant to each other. However, a correlation between them is nearly impossible because they are different types of things from the same field. And the final column, “Examples to avoid,” as the name suggests, showcases some examples of topics that would not make a good compare and contrast essay.
Choosing a Great Topic for a Comparison Essay
What you write about could make or break your paper. As in any academic work, a good compare and contrast essay will have a purpose that adds value. For this, consider topics that are helpful in your discipline. Effective compare and contrast topics should expand the universe of knowledge or valid claims that have not yet been proven. A few examples of topics include:
Education Compare and Contrast Essays Topics
- Home Education vs. Daycare: What will Suit your Child?
- Spice-Cake vs. Cane: What Works Better with Kids?
- E-learning vs. Conventional Learning.
- Learning System in Asia vs. the West.
- College Dream vs. Skills Acquisition.
- Textbooks vs. E-books.
- Private vs. Public College: Which will Suit You?.
- Parents’ Involvement in Children’s Career Choice vs. Self Discovery.
Sports Compare and Contrast Essays Topics
- Football or basketball: three-pointer in the soccer goal.
- Marathons and walkathons – similar in terms of endurance, will, and fitness. However, they are also different.
- Indoor vs. In Open Air Sports.
- Sport-Study Balance vs. High Focus studying .
- Early morning Exercise vs. Late night Exercise.
- Running vs. gymming: Which one is for you?.
- Home Exercise VS Gym Workout.
- Tennis or Badminton: Which is Harder?.
Politics Compare and Contrast Essays Topics
- Democracy, Monarchy, or Autocracy
- Socialism and Communism: Is It the Same?
- Merits of free trade vs. the demerits of Free Trade
- Centralized Government Vs. Decentralized Government
- Legislature and executive – Branches of Power to analyze
- Fundamental rights Vs. State Policy’s directive principles
- Equal opportunities versus affirmative action
Economy Compare and Contrast Essays Topics
- Economics as Mandatory Discipline or as an Optional Pick
- Peace vs. political unrest.
- Economics vs. business studies: What’s More Efficient?
- Regulated Prices vs. Free Market
- America Tax System vs. China Tax System
- New Laws vs Old Laws: Which is More Important
- Macro-Economics vs. Micro-Economics.
Social Studies Compare and Contrast Essays Topics
- Childhood in the 90s vs. Modern Day Childhood
- Coronavirus vs. The Great Depression
- COVID-19 vs. The Plague
- Common-Law Vs. Civil Law
- Rural Life to Urban Life
- America in the 60s Vs. America Now
History Compare and Contrast Essays Topics
- Lincoln’s Ideas vs. Washington’s ideas
- Baroque epoch vs. Renaissance
- Religious studies vs. Anthropology: Are They So Different?
- Napoleon Fall vs. Hitler Fall
- Democracy and monarchy
- The US and the UK Election System
- Nazism vs. Fascism: Is It the Same?
Literature Compare and Contrast Essays Topics
- Reality vs. Fiction Literature
- Depiction of Women in Literature in the 80s and Now
- Memoir vs. Autobiography
- Prose versus Poetry
- Shakespeare Piece: Othello vs. Hamlet
- English novels vs. French novels.
- Roman and Greek mythology.
Controversial Compare and Contrast Essay Topics
We believe that controversial compare-and-contrast essays are the most interesting ones. They include two opposite beliefs on the same question or situation and analyze their similarity or different points. It’s the most exciting essay type to write and overwhelming to read, so look at the list of top-rated topics for such articles:
- Intervention or Invasion: What is the Difference?
- Religion versus Atheism.
- LGBT++ Rights vs. Sexual Orientation Restriction.
- Death Penalty vs. Life Sentence: What is Worse?
- Climate Change vs. War: There Is Connection?
- Violent video games and Shooting games.
In addition to these academic subjects, you may be tasked to write a good application comparison essay when entering college. These topics could be more light-hearted and include comparing your youth with your adolescent years or comparing two close friends.
Pre-Writing Stage
![essay and report similarities pic](https://papersowl.com/wp-content/uploads/thumb/58/4cb28c35487f058_760x0.png)
The pre-writing stage is an indispensable phase in the essay-writing process, laying the foundation for a well-organized and insightful piece. Before diving into the actual writing, this preparatory stage allows you to explore, organize, and refine their thoughts. For compare and contrast essays, this often involves researching the chosen subjects to uncover detailed information, nuances, and perspectives. Techniques such as brainstorming can help identify key points of similarity and difference, while tools like Venn diagrams visually map out where subjects overlap and where they diverge. This visual representation can be particularly invaluable in determining the essay’s structure and focus. Additionally, the pre-writing stage is an opportune time to formulate a tentative thesis statement, which will provide direction and purpose as the essay evolves. By dedicating time to this initial phase, writers can ensure a clearer, more coherent essay, minimizing potential roadblocks and revisions later in the writing process. In essence, the pre-writing is akin to blueprinting; it’s where the groundwork is laid for the construction of a compelling narrative.
Thesis Statement
The thesis statement is the anchor of any well-structured essay, offering readers a concise snapshot of what to expect. In a compare and contrast essay, the thesis not only indicates the subjects to be compared but also the focus and purpose of the comparison. Begin by pinpointing the main similarities or differences you want to highlight. For instance, if comparing apples to oranges, your thesis might read: “While apples and oranges both provide essential vitamins and are popular fruits, they differ in texture, taste, and cultural significance.” This statement not only sets the subjects of comparison but also guides readers on the specific aspects being compared.
Crafting an effective thesis requires clarity and precision. It should avoid vague language and ensure that readers can anticipate the direction of the discussion. Remember, a strong thesis statement acts as a roadmap, helping to steer both the writer and the reader through the essay’s argumentative landscape.
![essay and report similarities more_shortcode](https://papersowl.com/wp-content/themes/wp-webtech-theme/components/stuck-shortcode/img/img.png)
Structure for a Compare and Contrast Essay
When setting out to write a compare and contrast essay, one of the initial and fundamental decisions you’ll need to make is regarding the essay’s structure. Your choice of structure can have a profound impact on the clarity and effectiveness of your presentation. Here’s how you can determine the best structure for your essay:
Understand Your Subjects:
- Before choosing a structure, you need a clear understanding of your subjects and the points of comparison. Are there numerous similarities and differences, or just a few major ones?
Purpose of the Essay:
- Are you trying to highlight the stark differences between your subjects, shed light on unexpected similarities, or do both? Your purpose can guide the structure.
Audience Consideration:
- Think about your readers. If your subjects are very unfamiliar to your audience, the block method might be better because it allows for a more in-depth exploration of each subject before contrasting.
Two Predominant Structures:
- Block Method: In this structure, you discuss all relevant points related to one subject and then move on to the next subject. This approach can be particularly useful if you want your readers to have an in-depth understanding of each subject before highlighting the contrasts.
✏️ Example: If you’re comparing apples and oranges, you would first discuss everything about apples and then everything about oranges.
- Point-by-Point Method: This is a more integrated approach. For each point of comparison, you alternate between the two subjects. This method keeps the comparison and contrast front and center and can make direct contrasts clearer.
✏️ Example: Discuss the color of apples and then the color of oranges, followed by the texture of apples and then the texture of oranges, and so on.
Whichever structure you choose, your primary goal should be clarity. Ensure that your points of comparison are clear and that readers can easily follow your reasoning. Remember, while these are the two primary structures, they are not set in stone. Depending on your topic, you might find it effective to blend these structures in some sections.
In conclusion, the structure you choose for your compare and contrast essay will significantly shape your argument’s presentation. While the block method allows for a deep dive into each subject separately, the point-by-point method maintains a tight focus on the comparison throughout the essay. Evaluate your subjects, your purpose, and your audience, and choose the structure that most effectively communicates your points.
Compare and Contrast Essay Outline
A good essay outline will contain, at a minimum, the three core sections – introduction, body, and conclusion. Often times the intro can be the most difficult to write, and it should be reserved for last. Once you have all your ideas laid out, hammering out a solid beginning is much easier to inform the reader what is to follow. You can pick out an interesting fact in your paper to write a strong hook to lure your readers in. Also, you’ll be able to tighten up your compare-and-contrast thesis to give a stronger impression.
Comparison Essay Outline Example
In this example, we’ll compare and contrast the essay point by point. In our comparison essay structure, we’ve elected to speak about similarities and follow up with differences and apply an extended conclusion with analysis and then the actual concluding paragraph for the scope of the paper.
![essay and report similarities pic](https://papersowl.com/wp-content/uploads/thumb/4d/d4ece8aac581f4d_760x0.jpg)
In our comparative essay outline example, we’ve put together a basic template of what the paper should look like. Mind you, this is an informal template for an introduction to compare and contrast essay. If your course requires you to submit a formal outline in APA or MLA style, be sure to draft one according to the latest style guide.
![essay and report similarities pic](https://papersowl.com/wp-content/uploads/thumb/ed/b40227042b79fed_760x0.jpg)
You can use this comparative essay outline template to draft your paper as a means to get your ideas out on paper. Like many students, you could be short on time or not have the ability to complete your paper. In this case, you can use our writing service, and we’ll draft a perfect custom text for you to meet any deadlines you have.
We all have our opinions and curiosities, and sharing them with the world is a fun experience. And you can through an effective contrast and comparison paper. Just be sure to pick subjects that can be analyzed and back up your conclusions with data, and you’ll be well on your way to unlocking the world’s inner workings. Sometimes you may find a lack of inspiration for a topic or are stressed to get a high grade. We are here to help 24/7/365 to get you out of a jam and write your papers for you in your time of need. So reach out to us, and we are here to help.
Tips to Write a Compare and Contrast Essay
![essay and report similarities pic](https://papersowl.com/wp-content/uploads/thumb/77/13828df50d81377_760x0.png)
If you’re wondering how to write a comparison essay fast, there are a few tricks to make the most of your time. Follow these steps professional writers use, and you’ll get your paper done to meet the tightest deadlines.
- Brainstorm on a scratch pad : You may be used to using your computer for everything, but for organizing your ideas, old-fashioned scratch paper works best. Draw a side-by-side chart and start listing out the characteristics of your subjects. Mention all the pros and cons, physical characteristics, as well as processes and applications that each possesses.
- Make sure to choose comparable subjects that will make sense to the reader.
- Ensure that the thesis statement is strong and to the point.
- Do good research and ensure that your arguments are clearly stated.
- Build your outline of compare and contrast essay : You can start to compare and contrast essay outline with your data table. Check the required length of your paper and start building a paragraph structure that will meet any bullet points and suffice the word count. Be sure to start off with your most interesting points to keep the reader engaged.
- Draft your paper : Be sure to include a catchy title that is on point with the contents of your work. As a general rule, try not to go over 12 words in your title. Also, note that the thesis statement for the comparison and contrast essay should relate to every section of your text.
- Use transitional words to make it easier for the reader to follow the arguments presented in your essay.
Transitional words and phrases are the connective tissues of an essay, ensuring the flow of ideas is seamless and readers can easily navigate the content. Especially crucial in compare and contrast essays, these transitions aid in clarifying comparisons or highlighting disparities. Words like “similarly,” “likewise,” and “equally” signal similarities between subjects, guiding the reader’s understanding of how two things align. Conversely, phrases such as “on the other hand,” “however,” and “in contrast” denote differences, emphasizing the distinct characteristics of each subject.
- Review your work : Now, it’s time to smooth out some rough patches in your initial draft and fine-tune some sections. Pay special attention to retaining your paper’s focus and meeting all the task requirements. Many students get stuck in this phase and, while they’ve met the requirements, are not happy with the final product. In this case, a comparison essay to buy is a great alternative. Hiring a specialist in your subject is the best way to get a good grade.
There are various factors to consider, such as structure, format, and even finding the right resources. Fortunately, cheap essay writing services such as PapersOwl make the process much easier. Simply provide your instructions, and their professional writers will create an original paper for you.
Comparison Essay Format
Universities are real sticklers for formatting. This may seem like an annoyance for many students, but academic work should be consistent across disciplines to aid analysts in efficiently referencing work and applying it to their own studies. Depending on your course, you may be required to write a comparison essay in MLA format or APA. So armed with the latest style guide of your choice, let’s get down to how to write a good comparison essay outline.
Bringing It All Together
Comparing and contrasting is an intrinsic part of our daily decision-making. From choosing restaurants to assessing products, we inherently evaluate based on similarities and differences. Yet, when tasked with a formal compare and contrast essay in academia, many students falter. This guide aims to simplify the process, providing structure and clarity. Emphasizing the importance of a solid thesis, structured format, and the use of transitional phrases, it offers a blueprint for effective essay writing.
Readers also enjoyed
![essay and report similarities Compare and Contrast Essay Topics For Students](https://papersowl.com/wp-content/uploads/thumb/4b/614e9b81c80074b_370x200.png)
WHY WAIT? PLACE AN ORDER RIGHT NOW!
Just fill out the form, press the button, and have no worries!
We use cookies to give you the best experience possible. By continuing we’ll assume you board with our cookie policy.
- How it works
![essay and report similarities researchprospect post subheader](https://www.researchprospect.com/wp-content/uploads/2024/05/3-3.webp)
What is the Difference Between Essays and Reports?
Published by Alaxendra Bets at August 19th, 2021 , Revised On August 23, 2023
What is the difference between essays and reports? Report writing is a specialised skill that your academic tutor would like you to develop.
Whether you are writing a report in university or business, report writing skills are equally important to get your message across to the readers effectively.
Generally, your academic tutor decides what form of writing you must undertake and will provide the layout requirements in the assignment brief.
However, as you move towards university-level study, you will have the freedom of choice to decide what form of writing you must undertake to address the problem question .
This means that you will need a critical evaluation of what form of writing will be the most appropriate for you, considering a given academic assignment’s requirements.
Whether you are a student or a professional, it is important to understand the key differences between an essay and a report to work out why you should prefer one form of writing over the other.
This article lists the most notable differences between a report and an essay, so whenever you are unsure about which form of writing is the most suitable, you will know exactly what decision is right or wrong.
Difference Between Essays and Reports – Purpose
Purpose of a report.
Typically you will be asked to write a report if you must present an analysis of practical research results. All reports start with the topic background, research aim, and objectives to provide details of what your work will examine.
You may also include a hypothesis in your report if you are testing a proposition with your research. Depending on your topic’s nature and the report writing guidelines laid out by your tutor, you may also have to include a separate section for future recommendations in your report.
Purpose of an Essay
On the other hand, Essays find answers to a question using the researcher’s own critical evaluation of the existing theories. An essay does not directly include any practical research because it only uses the existing literature material.
Difference Between Essays and Reports – Content
The report starts with introducing the topic and lists the aim and objectives your practical research will address.
It quickly moves to report chronological actions such as gathering data and presenting findings from primary research activities and laboratory experiments before the writer finally provides an assessment of the results in the conclusion and recommendations for future sections.
The content of an essay depends on the essay question you need to answer. Whether your essay must be evaluative, argumentative , narrative , discursive, or descriptive will be determined by the nature of your essay question.
However, in general, all essays involve a synthesis of knowledge obtained from existing literature on the given question and the writer’s personal arguments and opinions based on the evidence collected during research.
Whether you have been asked to write an essay or a report, ResearchProspect writers can help you achieve the highest academic grade. We have a large team of academic writers who can meet every bit of your requirements regardless of your academic level and the academic subject.
Difference Between Essays and Reports – Formatting
A report and an essay format are similar as both include an introduction , main body , and conclusion sections. Reports include methodology and analysis in the main body and have a fixed structure.
It is recommended to check your school’s formatting guidelines if you are unsure how to format your report. Further, you can get our professional report writing service that will help you achieve your desired grades.
If you are writing an essay, the essay question’s critical evaluation will determine the structure you must follow in your essay.
Stuck on a report writing assignment? We can help!
Our report writing service Features:
- Expert UK Writers
- Plagiarism-free
- Timely Delivery
- Thorough Research
- Rigorous Quality Control
![essay and report similarities Expert UK Writers](https://www.researchprospect.com/wp-content/uploads/2021/10/portrait-pensive-young-girl-making-notes-removebg-preview.png)
Difference Between Essays and Reports in a Table
Despite describing these differences, it may not be easy to distinguish between an essay and a report. For example , in some academic disciplines, essays are structured like reports, with headings separating the different parts of an essay. The best practice regarding the style and format suitable to your academic discipline would be to consult your academic tutor.
Learn More About Our Essay Services Order Now
Frequently Asked Questions
How do you differentiate between an essay or a report.
An essay is a concise piece of writing that presents an argument, opinion, or analysis with a clear introduction, body, and conclusion. A report is a structured document that conveys information, often including data, findings, and recommendations, typically with headings, sections, and sometimes visual aids.
You May Also Like
This article explains the important conceptions of rhetorical writing and provides tips on writing a first-class rhetorical analysis essay.
An essay outline – an underrated part of essay writing – brings forth the structure for the writers as they initiate the essay drafting process.
You can see the word ‘discursive’ is close to the word ‘discourse’; in short, it means involving discussion. In a discursive essay you explore
USEFUL LINKS
LEARNING RESOURCES
![essay and report similarities researchprospect-reviews-trust-site](https://www.researchprospect.com/wp-content/uploads/2023/06/researchprospect-reviews-trust-site.webp)
COMPANY DETAILS
![essay and report similarities Research-Prospect-Writing-Service](https://www.researchprospect.com/wp-content/uploads/2021/08/Research-Prospect-Writing-Service.webp)
- How It Works
![essay and report similarities Library homepage](https://cdn.libretexts.net/Logos/human_full.png)
- school Campus Bookshelves
- menu_book Bookshelves
- perm_media Learning Objects
- login Login
- how_to_reg Request Instructor Account
- hub Instructor Commons
Margin Size
- Download Page (PDF)
- Download Full Book (PDF)
- Periodic Table
- Physics Constants
- Scientific Calculator
- Reference & Cite
- Tools expand_more
- Readability
selected template will load here
This action is not available.
![essay and report similarities Humanities LibreTexts](https://a.mtstatic.com/@public/production/site_9956/1481233284-logo.png)
4.1: Introduction to Comparison and Contrast Essay
- Last updated
- Save as PDF
- Page ID 174873
\( \newcommand{\vecs}[1]{\overset { \scriptstyle \rightharpoonup} {\mathbf{#1}} } \)
\( \newcommand{\vecd}[1]{\overset{-\!-\!\rightharpoonup}{\vphantom{a}\smash {#1}}} \)
\( \newcommand{\id}{\mathrm{id}}\) \( \newcommand{\Span}{\mathrm{span}}\)
( \newcommand{\kernel}{\mathrm{null}\,}\) \( \newcommand{\range}{\mathrm{range}\,}\)
\( \newcommand{\RealPart}{\mathrm{Re}}\) \( \newcommand{\ImaginaryPart}{\mathrm{Im}}\)
\( \newcommand{\Argument}{\mathrm{Arg}}\) \( \newcommand{\norm}[1]{\| #1 \|}\)
\( \newcommand{\inner}[2]{\langle #1, #2 \rangle}\)
\( \newcommand{\Span}{\mathrm{span}}\)
\( \newcommand{\id}{\mathrm{id}}\)
\( \newcommand{\kernel}{\mathrm{null}\,}\)
\( \newcommand{\range}{\mathrm{range}\,}\)
\( \newcommand{\RealPart}{\mathrm{Re}}\)
\( \newcommand{\ImaginaryPart}{\mathrm{Im}}\)
\( \newcommand{\Argument}{\mathrm{Arg}}\)
\( \newcommand{\norm}[1]{\| #1 \|}\)
\( \newcommand{\Span}{\mathrm{span}}\) \( \newcommand{\AA}{\unicode[.8,0]{x212B}}\)
\( \newcommand{\vectorA}[1]{\vec{#1}} % arrow\)
\( \newcommand{\vectorAt}[1]{\vec{\text{#1}}} % arrow\)
\( \newcommand{\vectorB}[1]{\overset { \scriptstyle \rightharpoonup} {\mathbf{#1}} } \)
\( \newcommand{\vectorC}[1]{\textbf{#1}} \)
\( \newcommand{\vectorD}[1]{\overrightarrow{#1}} \)
\( \newcommand{\vectorDt}[1]{\overrightarrow{\text{#1}}} \)
\( \newcommand{\vectE}[1]{\overset{-\!-\!\rightharpoonup}{\vphantom{a}\smash{\mathbf {#1}}}} \)
The key to a good compare-and-contrast essay is to choose two or more subjects that connect in a meaningful way. Comparison and contrast is simply telling how two things are alike or different. The compare-and-contrast essay starts with a thesis that clearly states the two subjects that are to be compared, contrasted, or both. The thesis should focus on comparing, contrasting, or both.
Key Elements of the Compare and Contrast:
- A compare-and-contrast essay analyzes two subjects by either comparing them, contrasting them, or both.
- The purpose of writing a comparison or contrast essay is not to state the obvious but rather to illuminate subtle differences or unexpected similarities between two subjects.
- The thesis should clearly state the subjects that are to be compared, contrasted, or both, and it should state what is to be learned from doing so.
- Organize by the subjects themselves, one then the other.
- Organize by individual points, in which you discuss each subject in relation to each point.
- Use phrases of comparison or phrases of contrast to signal to readers how exactly the two subjects are being analyzed.
Objectives: By the end of this unit, you will be able to
- Identify compare & contrast relationships in model essays
- Construct clearly formulated thesis statements that show compare & contrast relationships
- Use pre-writing techniques to brainstorm and organize ideas showing a comparison and/or contrast
- Construct an outline for a five-paragraph compare & contrast essay
- Write a five-paragraph compare & contrast essay
- Use a variety of vocabulary and language structures that express compare & contrast essay relationships
Example Thesis: Organic vegetables may cost more than those that are conventionally grown, but when put to the test, they are definitely worth every extra penny.
![essay and report similarities Graphic Showing Organization for Comparison Contrast Essay](https://human.libretexts.org/@api/deki/files/106122/clipboard_e8a6328dd66f1b1d62b0020c7c2c5bd60.png?revision=1)
Sample Paragraph:
Organic grown tomatoes purchased at the farmers’ market are very different from tomatoes that are grown conventionally. To begin with, although tomatoes from both sources will mostly be red, the tomatoes at the farmers’ market are a brighter red than those at a grocery store. That doesn’t mean they are shinier—in fact, grocery store tomatoes are often shinier since they have been waxed. You are likely to see great size variation in tomatoes at the farmers’ market, with tomatoes ranging from only a couple of inches across to eight inches across. By contrast, the tomatoes in a grocery store will be fairly uniform in size. All the visual differences are interesting, but the most important difference is the taste. The farmers’ market tomatoes will be bursting with flavor from ripening on the vine in their own time. However, the grocery store tomatoes are often close to being flavorless. In conclusion, the differences in organic and conventionally grown tomatoes are obvious in color, size and taste.
![essay and report similarities Creative Commons Attribution](https://human.libretexts.org/@api/deki/files/106123/clipboard_e4850bba08d03b6eb0f0fc5ae504641b8.png?revision=1)
The Compare/Contrast Essay
The compare/contrast essay – similarities and differences come to light.
Writing a Compare/Contrast Essay Think of the Compare/Contrast essay as a bridge between both the Personal Essay and the Issues (Research) Essay. To begin, we often compare and contrast things in our everyday lives—what gas station to go to, what to major in, which job is better, etc. Sometimes comparing and contrasting allows one the possibility of gauging which choice (or perhaps subject) is more advantageous to you personally, or perhaps might be more beneficial on a larger scale (like when a company decides which health plan will provide its employees with the best benefits). Your purpose in this essay is to evaluate a subject or subjects. In another sense, comparing and contrasting affords one the possibility of shedding light on an issue or conflict, and works by illustrating both sides of the subject (or perhaps debate). If you wanted to provide an objective take on the current economic climate of the US, you might provide data (or facts) from both before and after the economic downturn of late. This would be considered a more informative approach here. While the latter is common, your essay should focus more on the former, where you will take a stance and make a judgment on the subject(s) at hand. This being the case then, your Compare/Contrast Essay should present both your perspective in relation to the subject(s) and provide evidence via a progression of logical arguments to support your claims. Compare/Contrast
- Involves juxtaposition → putting things (subjects/parts) side by side
- Illustrates the similarities/differences of a subject or subjects
- Might also illustrate the advantages/disadvantages of subject(s)
- Helps you organize information in arriving at a choice/decision/outcome
- Often used when someone makes a decision or has to choose
- Subjects must be similar enough, or could be various parts of a larger subject
- You should figure out the factors involved before writing
- Depending on the subject, some research may be necessary
- Common ways we compare/contrast → analogies → metaphors & similes
- Commonly used words or phrases to suggest similarities/comparisons: like, as, also, in a like manner, similarly, likewise, in addition
- Commonly used words or phrases to suggest differences/contrasts: but, in contrast to, unlike, whereas, on one hand, however, on the other hand
- Conclusion should reveal your ultimate choice/decision/outcome
Two common ways of organizing a Compare/Contrast Essay:
Factor-by-Factor or Subject-by-Subject
(will likely be influenced by purpose and audience) Factor-by-Factor (or Point-by-Point):
a) Subject A
b) Subject B
c) Subject C
2. Factor 2
3. Factor 3
Subject-by-Subject (or One-Side-at-a-Time):
A) Subject A
1. Factor 1
B) Subject B
C) Subject C
For more in-depth notes, a sample essay, and a helpful video for this rhetorical mode, please click here for compare and contrast .
- The Compare/Contrast Essay - Similarities and Differences Come to Light. Authored by : Jason Brown. Provided by : Herkimer College. Project : AtD OER Course. License : CC BY: Attribution
![essay and report similarities Search](https://www.eapfoundation.com/images/search.png)
- I nfographics
- Show AWL words
- Subscribe to newsletter
- What is academic writing?
- Academic Style
- What is the writing process?
- Understanding the title
- Brainstorming
- Researching
- First draft
- Proofreading
- Report writing
- Compare & contrast
- Cause & effect
- Problem-solution
- Classification
- Essay structure
- Introduction
- Literature review
- Book review
- Research proposal
- Thesis/dissertation
- What is cohesion?
- Cohesion vs coherence
- Transition signals
- What are references?
- In-text citations
- Reference sections
- Reporting verbs
- Band descriptors
Show AWL words on this page.
Levels 1-5: grey Levels 6-10: orange
Show sorted lists of these words.
Any words you don't know? Look them up in the website's built-in dictionary .
Choose a dictionary . Wordnet OPTED both
Compare & Contrast Essays How things are similar or different
Compare and contrast is a common form of academic writing, either as an essay type on its own, or as part of a larger essay which includes one or more paragraphs which compare or contrast. This page gives information on what a compare and contrast essay is , how to structure this type of essay, how to use compare and contrast structure words , and how to make sure you use appropriate criteria for comparison/contrast . There is also an example compare and contrast essay on the topic of communication technology, as well as some exercises to help you practice this area.
What are compare & contrast essays?
![essay and report similarities compare](https://www.eapfoundation.com/images/candc_screen442.png)
For another look at the same content, check out YouTube » or Youku » , or this infographic » .
![essay and report similarities essay and report similarities](https://www.eapfoundation.com/images/infog1.png)
To compare is to examine how things are similar, while to contrast is to see how they differ. A compare and contrast essay therefore looks at the similarities of two or more objects, and the differences. This essay type is common at university, where lecturers frequently test your understanding by asking you to compare and contrast two theories, two methods, two historical periods, two characters in a novel, etc. Sometimes the whole essay will compare and contrast, though sometimes the comparison or contrast may be only part of the essay. It is also possible, especially for short exam essays, that only the similarities or the differences, not both, will be discussed. See the examples below.
- Compare and contrast Newton's ideas of gravity with those proposed by Einstein ['compare and contrast' essay]
- Examine how the economies of Spain and China are similar ['compare' only essay]
- Explain the differences between Achaemenid Empire and Parthian Empire ['contrast' only essay]
There are two main ways to structure a compare and contrast essay, namely using a block or a point-by-point structure. For the block structure, all of the information about one of the objects being compared/contrasted is given first, and all of the information about the other object is listed afterwards. This type of structure is similar to the block structure used for cause and effect and problem-solution essays. For the point-by-point structure, each similarity (or difference) for one object is followed immediately by the similarity (or difference) for the other. Both types of structure have their merits. The former is easier to write, while the latter is generally clearer as it ensures that the similarities/differences are more explicit.
The two types of structure, block and point-by-point , are shown in the diagram below.
Compare and Contrast Structure Words
Compare and contrast structure words are transition signals which show the similarities or differences. Below are some common examples.
- both... and...
- not only... but also...
- neither... nor...
- just like (+ noun)
- similar to (+ noun)
- to be similar (to)
- to be the same as
- to be alike
- to compare (to/with)
- Computers can be used to communicate easily, for example via email. Similarly/Likewise , the mobile phone is a convenient tool for communication.
- Both computers and mobile phones can be used to communicate easily with other people.
- Just like the computer, the mobile phone can be used to communicate easily with other people.
- The computer is similar to the mobile phone in the way it can be used for easy communication.
- In contrast
- In comparison
- By comparison
- On the other hand
- to differ from
- to be different (from)
- to be dissimilar to
- to be unlike
- Computers, although increasingly small, are not always easy to carry from one place to another. However , the mobile phone can be carried with ease.
- Computers are generally not very portable, whereas the mobile phone is.
- Computers differ from mobile phones in their lack of portability.
- Computers are unlike mobile phones in their lack of portability.
Criteria for comparison/contrast
When making comparisons or contrasts, it is important to be clear what criteria you are using. Study the following example, which contrasts two people. Here the criteria are unclear.
- Aaron is tall and strong. In contrast , Bruce is handsome and very intelligent.
Although this sentence has a contrast transition , the criteria for contrasting are not the same. The criteria used for Aaron are height (tall) and strength (strong). We would expect similar criteria to be used for Bruce (maybe he is short and weak), but instead we have new criteria, namely appearance (handsome) and intelligence (intelligent). This is a common mistake for students when writing this type of paragraph or essay. Compare the following, which has much clearer criteria (contrast structure words shown in bold).
- Aaron and Bruce differ in four ways. The first difference is height. Aaron is tall, while Bruce is short. A second difference is strength. Aaron is strong. In contrast , Bruce is weak. A third difference is appearance. Aaron, who is average looking, differs from Bruce, who is handsome. The final difference is intelligence. Aaron is of average intelligence. Bruce, on the other hand , is very intelligent.
Example essay
Below is a compare and contrast essay. This essay uses the point-by-point structure . Click on the different areas (in the shaded boxes to the right) to highlight the different structural aspects in this essay, i.e. similarities, differences, and structure words. This will highlight not simply the paragraphs, but also the thesis statement and summary , as these repeat the comparisons and contrasts contained in the main body.
Title: There have been many advances in technology over the past fifty years. These have revolutionised the way we communicate with people who are far away. Compare and contrast methods of communication used today with those which were used in the past.
Before the advent of computers and modern technology, people communicating over long distances used traditional means such as letters and the telephone. Nowadays we have a vast array of communication tools which can complete this task, ranging from email to instant messaging and video calls. While the present and previous means of communication are similar in their general form , they differ in regard to their speed and the range of tools available . One similarity between current and previous methods of communication relates to the form of communication. In the past, both written forms such as letters were frequently used, in addition to oral forms such as telephone calls. Similarly , people nowadays use both of these forms. Just as in the past, written forms of communication are prevalent, for example via email and text messaging. In addition, oral forms are still used, including the telephone, mobile phone, and voice messages via instant messaging services. However , there are clearly many differences in the way we communicate over long distances, the most notable of which is speed. This is most evident in relation to written forms of communication. In the past, letters would take days to arrive at their destination. In contrast , an email arrives almost instantaneously and can be read seconds after it was sent. In the past, if it was necessary to send a short message, for example at work, a memo could be passed around the office, which would take some time to circulate. This is different from the current situation, in which a text message can be sent immediately. Another significant difference is the range of communication methods. Fifty years ago, the tools available for communicating over long distances were primarily the telephone and the letter. By comparison , there are a vast array of communication methods available today. These include not only the telephone, letter, email and text messages already mentioned, but also video conferences via software such as Skype or mobile phone apps such as WeChat, and social media such as Facebook and Twitter. In conclusion, methods of communication have greatly advanced over the past fifty years. While there are some similarities, such as the forms of communication , there are significant differences, chiefly in relation to the speed of communication and the range of communication tools available . There is no doubt that technology will continue to progress in future, and the advanced tools which we use today may one day also become outdated.
![essay and report similarities Academic Writing Genres](https://www.eapfoundation.com/images/EAPF-Academic-Writing-Genres1.jpg)
GET FREE EBOOK
Like the website? Try the books. Enter your email to receive a free sample from Academic Writing Genres .
Below is a checklist for compare and contrast essays. Use it to check your own writing, or get a peer (another student) to help you.
There is a downloadable graphic organiser for brainstorming ideas for compare and contrast essays in the writing resources section.
Next section
Find out how to write cause & effect essays in the next section.
- Cause/effect
Previous section
Go back to the previous section about persuasion essays .
You need to login to view the exercises. If you do not already have an account, you can register for free.
- Register
- Forgot password
- Resend activiation email
![essay and report similarities logo](https://www.eapfoundation.com/images/logoMF_400px.png)
Author: Sheldon Smith ‖ Last modified: 08 January 2022.
Sheldon Smith is the founder and editor of EAPFoundation.com. He has been teaching English for Academic Purposes since 2004. Find out more about him in the about section and connect with him on Twitter , Facebook and LinkedIn .
Compare & contrast essays examine the similarities of two or more objects, and the differences.
Cause & effect essays consider the reasons (or causes) for something, then discuss the results (or effects).
Discussion essays require you to examine both sides of a situation and to conclude by saying which side you favour.
Problem-solution essays are a sub-type of SPSE essays (Situation, Problem, Solution, Evaluation).
Transition signals are useful in achieving good cohesion and coherence in your writing.
Reporting verbs are used to link your in-text citations to the information cited.
- Open access
- Published: 14 May 2024
CAR T cells outperform CAR NK cells in CAR-mediated effector functions in head-to-head comparison
- Lukas Egli 1 ,
- Meike Kaulfuss 1 ,
- Juliane Mietz 1 ,
- Arianna Picozzi 1 ,
- Els Verhoeyen 2 , 3 ,
- Christian Münz 4 &
- Obinna Chijioke 1 , 5
Experimental Hematology & Oncology volume 13 , Article number: 51 ( 2024 ) Cite this article
45 Accesses
3 Altmetric
Metrics details
CAR NK cells as vehicles for engineered “off-the-shelf” cellular cancer immunotherapy have attracted significant interest. Nonetheless, a comprehensive comparative assessment of the anticancer activity of CAR T cells and CAR NK cells carrying approved benchmark anti-CD19 CAR constructs is missing. Here, we report a direct head-to-head comparison of CD19-directed human T and NK cells.
We generated CAR T and CAR NK cells derived from healthy donor PBMC by retroviral transduction with the same benchmark second-generation anti-CD19 CAR construct, FMC63.28z. We investigated IFN-γ secretion and direct cytotoxicity in vitro against various CD19 + cancer cell lines as well as in autologous versus allogeneic settings. Furthermore, we have assessed anticancer activity of CAR T and CAR NK cells in vivo using a xenograft lymphoma model in an autologous versus allogeneic setting and a leukemia model.
Our main findings are a drastically reduced capacity for CAR-mediated IFN-γ production and lower CAR-mediated cytotoxicity of CAR NK cells relative to CAR T cells in vitro. Consistent with these in vitro findings, we report superior anticancer activity of autologous CAR T cells compared with allogeneic CAR NK cells in vivo.
Conclusions
CAR T cells had significantly higher CAR-mediated effector functions than CAR NK cells in vitro against several cancer cell lines and autologous CAR T cells outperformed allogeneic CAR NK cells both in vitro and in vivo. CAR NK cells will likely benefit from further engineering to enhance anticancer activity to ultimately fulfill the promise of an effective off-the-shelf product.
Autologous anti-CD19 CAR T cell products have changed the treatment landscape for relapsed or refractory B cell malignancies by delivering unprecedented patient benefit, thus prompting their rapid approval in several countries [ 1 , 2 ]. However, although CAR T cell therapy is potentially curative in a proportion of patients [ 3 ], there are still several limitations. These include a time-consuming production process [ 2 ], high costs [ 4 ] and severe toxicities associated with CAR T cell therapy [ 5 , 6 ]. Therefore, besides engineered allogeneic CAR T cells [ 7 ], the use of allogeneic CAR NK cells is being pursued as an alternative [ 8 ], raising the prospect of more affordable and more readily available, scalable off-the-shelf products [ 9 ]. Indeed, early clinical data of treatment with partially or fully HLA-mismatched cord blood derived anti-CD19 CAR NK cells have been reported and treatment shown to be remarkably safe, with none of the patients developing neurotoxicity or graft-versus-host disease, and highly potent [ 10 , 11 ]. However, while HER2 directed CAR T and CAR NK cells have been compared [ 12 ], there are no direct comparison studies to date of human anti-CD19 CAR T cells versus CAR NK cells.
Here, using a CD28 costimulatory domain-containing CAR design, as used in clinical trials of both CAR NK [ 10 , 11 ] and CAR T cells [ 13 , 14 ], we report significantly reduced CAR-mediated IFN-γ production and cytotoxicity after acute and chronic CAR stimulation by CAR NK cells compared with CAR T cells against various CD19 positive cancer cell lines in vitro in a head-to-head comparison. To model anticipated off-the-shelf applications, we compared autologous CAR T cells with allogeneic CAR NK cells in vitro and in vivo in a xenograft lymphoma model and found that autologous CAR T cells had superior anticancer activity.
Primary cells and cell lines
Primary human immune cells were purified from peripheral blood mononuclear cells (PBMC) of healthy donors by density gradient centrifugation (Ficoll Paque Premium, GE Healthcare, 17-5442-03) followed by isolation of B, T and NK cells by FACS sorting. For expansion of primary human T and NK cells, K562mbIL21 feeder cells (kindly provided by Dr. Dean Lee, Nationwide Children’s Hospital, Columbus, United States) were irradiated with 130 Gy and added once per week, starting at a 1:2 lymphocytes to feeder cell ratio on day 0 and continued with a 1:1 ratio, as described previously [ 15 ]. Expansion (complete) media for primary human NK and T cells based on RPMI1640 medium (Gibco, 52400–041) was supplemented with 10% fetal bovine serum (FBS; Merck, S0615), 1% penicillin/streptomycin (P/S; Gibco, 15140–122), 2 mM L-Glutamine (Gibco, 25030–164) and 100 IU/ml recombinant human IL-2 (PeproTech, 200–02) and replaced every 3–4 days. CAR T and CAR NK cells were expanded on feeder cells for 3–4 weeks before being used in downstream applications. Alternatively, sorted T cells were activated and expanded by CD3/CD28 co-stimulation using Dynabeads ™ (Gibco, 11131D). After isolation, 1 × 10 6 T cells were activated with 5 × 10 5 beads. Expansion media based on RPMI1640 medium (Gibco, 52400–041) was supplemented with 10% fetal bovine serum (FBS; Merck, S0615), 1% penicillin/streptomycin (P/S; Gibco, 15140–122), 2 mM L-Glutamine (Gibco, 25030–164) and 50 IU/ml recombinant human IL-2 (PeproTech, 200–02) and replaced every 2–3 days. CAR T cells were expanded for 3 weeks and then used in subsequent assays.
2.5 × 10 5 primary human B cells were plated in a 96-well flat-bottom plate and cultured with EBV supernatant (EBV B95-8; produced as previously described [ 16 ]) at an MOI of 0.1 to generate lymphoblastoid cell lines (LCL). Jurkat, NALM6, Raji, 721.221 and LCL were cultured in RPMI1640 medium supplemented with 10% FBS, 2 mM L-Glutamine and 1% P/S and passaged twice per week. Human embryonic kidney (HEK293T) cells were cultured in DMEM (Gibco, 41966–052) supplemented with 10% FBS, 2 mM L-Glutamine and 1% P/S and passaged 2–3 times per week. Cells underwent regular testing for mycoplasma using MycoSPY Master Mix (Biontex, M020-050).
Virus production
HEK293T cells were transfected with the packaging plasmid pUMVC (Addgene #8449), the BaEVRless envelope plasmid and the second-generation anti-CD19 CAR vector plasmid MSGV FMC63.28z, containing a CD28 costimulatory domain (kindly provided by James N. Kochenderfer, NCI, Bethesda, USA), at a ratio of 1:1:4 using polyethyleneimine (PEI) at DNA:PEI ratio of 1:6. Supernatant was collected 48 h after transfection and either used directly or stored at −80 °C until further use.
Retroviral transduction
On day 3 after isolation, 0.5–1 × 10 6 NK or T cells were resuspended in 0.5–1 ml of viral supernatant and transduced in a 24-well plate by spinfection (1.5 h, 1500xg, 32 °C) and in the presence of 0.8 µg/ml polybrene (EMD Millipore, TR-1003-G). Viral supernatant was replaced by fresh complete medium immediately after spinfection. CAR expression was assessed by flow cytometry 3 days after transduction.
Editing of target cells
CD19 negative 721.221 cells were generated by CRISPR/Cas9-mediated knockout (KO) of CD19. The crRNA (CGAGGAACCTCTAGTGGTGA) was designed in-house using CRISPOR [ 17 ] and purchased from Integrated DNA Technologies (IDT) as well as the tracrRNA (IDT, 1072533), and Cas9 ( Streptococcus pyogenes ) protein (IDT, 1081058). The formation of Cas9 ribonucleoproteins (RNPs) was performed as described by Roth et al [ 18 ]. 2.5 × 10 6 LCL 721.221 cells were electroporated per 100 µl Nucleocuvette ™ with RNPs using the P3 primary cell 4D-Nucleofector ™ X kit L, 12 reactions (Lonza, V4XP-3012) and pulsed with code DN-100. FACS sorting of CD19 negative cells was performed using a FACSAria III cell sorter (BD), nozzle size 130 µm. CD19 KO efficiency was confirmed and regularly checked by flow cytometry.
Flow cytometry
Surface markers cells were stained for 20 min at 4 °C in PBS, washed, and in case of viral transduction fixed with 1% paraformaldehyde-containing PBS. For intracellular markers, cells were fixed with the BD Pharmingen ™ Transcription factor buffer set (BD, 562574) and then stained for 1 h at 4 °C. Dead cells were detected using Zombie Aqua ™ (Biolegend, 423101), Zombie NIR (Biolegend, 423105) or for functional assays with TO-PRO ™ -3 Iodide (Invitrogen, T3605). For cells transduced with the MSGV FMC63.28z, CAR expression was assessed using PE-labeled recombinant human CD19 (Acro Biosystems, CD9-HP2H3) according to the manufacturer’s instructions. Samples were acquired on a BD LSRFortessa ™ flow cytometer (BD) or Cytek Aurora (Cytek). Flow data was analyzed using FlowJo software (Tree Star). The following antibodies were used (fluorochrome, clone, manufacturer, catalogue number; if not stated otherwise all antibodies were anti-human): CD103 (BV711, Ber-ACT8, Biolegend, 350222), CD119 (PE, GIR-208, Biolegend, 308606), CD158a,h (APC, EB6B, Beckman Coulter, PNA22332), CD158b1/b2,j (APC, GL183, Beckman Coulter, PNA22333), CD158e1/2 (APC, DX9, R&D Systems, FAB1225A), CD159a (PE-Cy5, S19004C, Biolegend, 375111), CD16 (BUV, 3G8, BD, 612786), CD19 (BUV661, HIB19, BD, 741604), CD19 (BV785, HIB19, Biolegend, 302240), CD2 (BV605, RPA-2.10, Biolegend, 300,224), CD3 (BV785, OKT3, Biolegend, 317329), CD3 (BUV496, UCHT1, BD, 612941), CD3 (FITC, UCHT1, Biolegend, 300406), CD39 (PE-Fire 810, A1, Biolegend, 328245), CD4 (BUV496, SK3, BD, 564652), CD4 (APC, OKT4, Biolegend, 317416), CD45 (BUV395, HI30, BD, 563792), CD45 (Pacific Blue, HI30, Biolegend, 304029), CD45RA (FITC, HI100, Biolegend, 304106), CD49a (FITC, TS2/7, Biolegend, 328308), CD56 (PE-Cy7, NCAM16, BD, 335826), CD57 (PE-Dazzle594, HNK-1, Biolegend, 359619), CD62L (Pacific Blue, DREG-56, Biolegend, 304825), CD69 (BUV805, FN50, BD, 748763), CD8 (BUV563, RPA-T8, BD, 612914), CD8 (BV650, SK1, Biolegend, 344730), EOMES (PerCP-eFluor710, eBioscience, 46-4877-42), Granzyme B (Alexa Fluor 700, GB11, BD, 560213), HLA-DR (PE-Fire 640, L243, Biolegend, 307676), Ki67 (BV605/BV711, Ki-67, Biolegend, 350522/350516), PD1 (BUV737, EH12.1, BD, 612792), Perforin (BV421, dG9, Biolegend, 308122), Tbet (BV650, O4-46, BD, 564142), TCF1 (PE, 7F11A10, Biolegend, 655207), Tim3 (BV650, 7D3, BD, 565565), Tim3 (APC-Cy7, F83-2E2, Biolegend, 345025), TOX (APC, REA-473, Miltenyi, 130-118-335).
Functional in vitro assays
For cytotoxicity assays, 721.221, NALM6, Raji and LCL were labeled with PKH26 red fluorescent cell linker (Sigma, MINI26-1KT). Labeled target cells and primary cells were cocultured for 4 h at the indicated effector to target (E:T) ratio. Right before acquisition, TO-PRO ™ -3 Iodide, was added to the sample [ 19 ]. Specific lysis was calculated as % dead labeled target cells—% spontaneous lysis of labeled target cells. For restimulation, effector cells were cocultured in fresh medium with or without IL-2 with unlabeled target cells for 24 h at an E:T ratio of 5:1. Medium was then replaced with medium without IL-2 and labeled target cell were added. For long-term coculture, 1 × 10 5 effector cells were seeded in a 96-well plate and 2 × 10 4 target cells added. At the indicated time points, half of the medium was exchanged and 2 × 10 4 unlabeled target cells and 100 IU/ml IL-2 added. On the last day, medium was replaced completely with medium without IL-2 and 2 × 10 4 labeled target cell were added.
After coculture, the concentration of secreted IFN-γ was measured according to the manufacturer’s protocol using the Human IFN-gamma DuoSet ELISA (R&D, DY285B-05). Alternatively, effector cells were stimulated with 50 ng/ml phorbol 12-myristate 13-acetate (PMA, Sigma, P1585) and 0.65 µM ionomycin (Biolegend, 420701) for 4 h and IFN-γ measured by ELISA. Plates were acquired using an ELISA reader (infinite M200Pro, Tecan) and analyzed with the i-control 2.0 software (Tecan).
CAR-mediated effector functions (cytotoxicity and IFN-γ production) were calculated by subtracting values of untransduced cells from the transduced cells of the same donor.
In vivo experiments
NSG (NOD.Cg-Prkdc < scid > Il2rg < tm1Wjl > /SzJ (#005557)) mice were purchased from The Jackson Laboratory and bred and housed under specific pathogen-free conditions at the Laboratory Animal Services Center (LASC) Zurich, University of Zurich. All animal experiments were performed according to an approved license by the veterinary office of the canton of Zurich, Switzerland (ZH049/20).
Subcutaneous LCL model: LCL tumors were injected subcutaneously into the left flank under isoflurane narcosis. 2 × 10 6 tumor cells were resuspended in PBS and right before injection mixed at a 1:1 V/V ratio with Corning ® Matrigel ® Growth Factor Reduced (GFR) Basement Membrane Matrix (Corning, 354230).
Three days after tumor injection, 4 × 10 6 or 10 × 10 6 effector cells were adoptively transferred by tail vein injection and mice injected intraperitoneally (i.p.) with 1 × 10 5 IU IL-2 every second day. Tumor size was monitored by calipering (3x/week or daily). Tumor volume was approximated with the following formula:
Systemic NALM6 model: 5 × 10 5 luciferase-expressing NALM6 cells (kindly provided by Dr. Chiara Magnani, University Hospital Zurich, Switzerland) were injected intravenously. Four days after tumor inoculation, effector cells were adoptively transferred by tail vein injection and mice injected intraperitoneally (i.p.) with 1 × 10 5 IU IL-2 every second day. Tumor growth was assessed weekly by measuring bioluminescence after intraperitoneal injection of luciferin (VivoGlo ™ Luciferin, Promega, P1043). Measurements were performed using the IVIS Lumina (PerkinElmer) and data analyzed with the Living Image Software (PerkinElmer).
General health was monitored by weighing and health parameter scoring (3x/week or daily, according to animal license). Persistence of adoptively transferred cells was monitored by tail vein bleeding. Blood was treated with ammonium chloride potassium (ACK) lysis buffer (Gibco), washed with PBS, stained and analyzed by flow cytometry.
At sacrifice, blood was collected by heart puncture and treated with ACK lysis buffer. Spleens were meshed through a 70 µm cell strainer and lymphocytes isolated by density gradient centrifugation. For isolation of tumor infiltrating lymphocytes, skin covering the tumor was removed and tumors cut into pieces with scissors, digested in DMEM with 2% heat-inactivated FBS and supplemented with 1 mg/mL collagenase IV (Roche, 11088866001), 40 µg/mL DNase I (Roche, 4716728001) and 1.2 mM CaCl 2 for 45 min at 37 °C and 200 rpm, meshed through a 70 μm cell strainer and washed twice with PBS. All single cell suspensions were then stained and analyzed by flow cytometry.
Statistical analysis was performed using Prism 10 Software (GraphPad Software, Inc). p values lower than 0.05 were considered significant. The statistical tests used as well as the number of biological replicates are specified in the figure legends.
Generation and expansion of anti-CD19 human CAR T and CAR NK cells
After isolation by FACS sorting (Fig. S1A) from healthy donor PBMCs, both human T and human NK cells were expanded using a feeder cell line (K562 cells expressing membrane-bound IL-21 [ 20 ]) and IL-2 supplementation, as has been reported previously for expansion of NK cells in clinical trials [ 10 , 11 , 21 , 22 ] (Fig. 1 A). Following an initial expansion period of three days, both T and NK cells were efficiently transduced using a retroviral vector pseudotyped with a baboon retroviral envelope glycoprotein [ 23 ], resulting in high level expression in both cell types of a second-generation anti-CD19 CAR (FMC63.28z [ 24 ]) with a mean of 64.5% CAR T cells and a mean of 70.35% CAR NK cells (Fig. 1 B, C). Over the course of three weeks, both transduced and untransduced human T and NK cells could be expanded over 1000-fold on average, with high lineage purity maintained (Fig. S1B) and without significant expansion differences between T and NK cells or transduced and untransduced cells (Fig. 1 D, E). Taken together, this protocol allowed for clinically relevant ex vivo expansion of human T and NK cells and high transduction efficiencies, thereby obviating the need for sorting of CAR cells.
![essay and report similarities figure 1](https://media.springernature.com/lw685/springer-static/image/art%3A10.1186%2Fs40164-024-00522-6/MediaObjects/40164_2024_522_Fig1_HTML.png)
Generation and expansion of CAR T and CAR NK cells. A Timeline of the generation and expansion of immune effector cells. (B, C) PBMC-derived primary human T and NK were transduced with a retroviral vector encoding an anti-CD19 CAR (FMC63.28z). Three days after transduction, CAR expression was measured by flow cytometry after staining with PE-labelled recombinant CD19. B Representative contour plot showing CAR expression on CAR T cells (left) and CAR NK cells (right). C Summary of transduction rates of T and NK cells. D , E CAR and untransduced cells were expanded for three weeks with weekly stimulation with K562mbIL21 feeder cells with addition of 100 U/ml IL-2. Logarithmic expansion over 3 weeks ( D ) and total expansion on day 21 ( E ). Data are from 5 independent experiments with n = 12 donors ( C ) and from 2 independent experiments with n = 6 donors ( D , E ). Significance by paired t-test (C) and RM one-way ANOVA with Tukey’s multiple comparisons ( E ). Symbols in ( C ) and ( E ) represent individual donors. Data shown as box and whiskers display the median as a line within the box; whiskers are shown from minimum to maximum data point
Phenotype of expanded CAR T and CAR NK cells
The expansion of both CAR T cells and untransduced T cells led to the preferential expansion of CD8 + T cells (Fig. 2 A ). The majority of expanded T cells displayed an effector memory (T EM )-like phenotype (CD45RA − CD62L − ) with a minor fraction of T EMRA (CD45RA + CD62L − ) cells (Fig. 2 B). Post-expansion, both untransduced T cells and CAR T cells exhibited increased expression of the activation and proliferation markers HLA-DR, CD69 and Ki-67 in comparison to baseline T cells as well as upregulation of the exhaustion markers CD39 and Tim-3, while PD-1 was reduced (Fig. 2 C, D and Fig. S2B). The cytolytic effector molecules perforin and especially granzyme B were upregulated as was the exhaustion-associated transcriptional regulator TOX [ 25 ] (Fig. 2 C, D and Fig. S2B), while TCF-1, marking stemness and progenitor populations [ 26 ], was downregulated (Fig. 2 C, D and Fig. S2B). We did not detect major phenotypic differences between untransduced and CAR T cells after expansion, except for slightly upregulated HLA-DR and lower perforin expression in CAR T cells (Fig. S2A, B). Expression of NK cell markers (KIR, CD56) was increased in expanded untransduced and CAR T cells (Fig. S2C). We also generated CAR T cells using a protocol based on CD3/CD28 costimulation, as this is more commonly used for clinical CAR T cell products [ 27 , 28 ] (Fig. S3A). We observed similar transduction rates (Fig. S3B), but a higher fraction of CD4 + T cells (Fig. S3C) and relative higher abundance of naïve and central memory-like phenotypes (Fig. S3D). Furthermore, these CAR T cells exhibited a less activated/exhausted-like phenotype relative to CAR T cells expanded with feeder cells (Fig. S3E). However, the potency of the feeder-based CAR T cell product was comparable to that of the CD3/CD28-based CAR T cell product, as evidenced by similar levels of cytotoxicity (Fig. S3F). Together, expanded CAR T cells exhibited a highly activated effector-like phenotype with distinct expression of exhaustion markers.
![essay and report similarities figure 2](https://media.springernature.com/lw685/springer-static/image/art%3A10.1186%2Fs40164-024-00522-6/MediaObjects/40164_2024_522_Fig2a_HTML.png)
Phenotype of expanded CAR T and untransduced T cells CAR T cells or untransduced T cells were expanded for 3 weeks and phenotype analyzed by flow cytometry. A Flow cytometric analysis of CD4 and CD8 expression and percentages of CD4 + and CD8 + T cells within freshly isolated CD3 + T cells (baseline), expanded untransduced T cells and expanded CAR T cells. B Flow cytometric analysis of T cell differentiation and percentages of naïve (T N , CD45RA + CD62L + ), central memory (T CM , CD45RA − CD62L + ), effector memory (T EM , CD45RA − CD62L − ) and T EMRA (CD45RA + CD62L − ) cells within T cell populations. ( C ) Representative contour plots showing marker expression in freshly isolated CD3 + T cells and expanded CAR T cells. ( D ) Heat map showing differences in marker expression in CD3 + T cells freshly isolated from PBMCs vs. expanded untransduced T cells and freshly isolated CD3 + T cells vs. expanded CAR T cells. Data are from 3 independent experiments with n = 6–9 donors. Significance by RM one-way ANOVA with Tukey’s multiple comparisons or 2way ANOVA with Tukey’s multiple comparisons as appropriate; *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001. Symbols in ( A ) and ( B ) represent individual donors. Data shown as box and whiskers display the median as a line within the box; whiskers are shown from minimum to maximum data point
Expanded NK cells showed higher intensity of CD56 compared with freshly isolated NK cells, which is not unexpected as CD56 has also been described as an NK cell activation marker [ 29 ] (Fig. 3 A). CD16 and CD2, both being critical for antibody-dependent cell-mediated cytotoxicity (ADCC) [ 30 , 31 ], showed opposite changes in expression post-expansion. Whereas CD16 was slightly downregulated, CD2 was expressed at higher frequencies on NK and CAR NK cells after expansion (Fig. 3 B, D and Fig. S4B). The activation and residency marker CD69 was upregulated as was CD49a, usually a marker for tissue residency. Interestingly, expansion resulted in reduced frequencies of CD57 + NK cells, likely due to depletion of terminally differentiated NK cells within the highly proliferative (Ki-67 + ) NK cell population (Fig. 3 B, D and Fig. S4B). The inhibitory receptor NKG2A was markedly upregulated while expression of killer cell immunoglobulin-like receptors (KIRs) was slightly but non-significantly decreased (Fig. 3 C, D and Fig. S4B). The cytolytic effector molecules perforin and granzyme B were co-expressed in the majority of freshly isolated NK cells and both remained high or even had increased expression after expansion (Fig. 3 C, D and Fig. S4B). Almost all freshly isolated NK cells expressed T-bet and most co-expressed Eomes, both of which are important transcription factors for NK cell maturation and effector functions [ 32 ]. Over the course of expansion, T-bet was downregulated while Eomes expression was increased (Fig. 3 C, D and Fig. S4B). Similar to expanded T cells, we did not observe major phenotypic differences between untransduced NK cells and CAR NK cells post-expansion (Fig. S4A, B). Thus, expanded CAR NK cells acquired a phenotype that resembled a not fully matured [ 33 ] but activated and cytotoxic NK cell state, a phenotype driven by expansion but not transduction itself.
![essay and report similarities figure 3](https://media.springernature.com/lw685/springer-static/image/art%3A10.1186%2Fs40164-024-00522-6/MediaObjects/40164_2024_522_Fig3_HTML.png)
Phenotype of expanded CAR NK and untransduced NK cells. CAR NK cells or untransduced NK cells were expanded for 3 weeks and phenotype analyzed by flow cytometry. A Representative histograms of CD56 expression (left) and average CD56 intensity (MFI) on freshly isolated CD3 − CD56 + NK cells (baseline) and expanded NK populations. (B, C) Representative contour plots showing expression of markers of NK cell differentiation, residency and proliferation ( B ), NKG2A, KIR, cytolytic effector molecules as well as transcription factors T-bet and Eomes ( C ) on freshly isolated NK cells and expanded CAR NK cells. D Heat map showing differences in marker expression in NK T cells freshly isolated from PBMCs vs. expanded untransduced NK cells and freshly isolated NK cells vs. expanded CAR NK cells. Data are from 3 independent experiments with n = 5–9 donors. Significance by RM one-way ANOVA with Tukey’s multiple comparisons or one-way ANOVA with Tukey’s multiple comparisons as appropriate; *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001. Symbols in ( A ) represent individual donors. Data shown as box and whiskers display the median as a line within the box; whiskers are shown from minimum to maximum data point
In vitro functionality of expanded CAR T and CAR NK cells
Next, we investigated the functionality of CAR T and CAR NK cells, including untransduced expanded T and NK cells, by short-term coculture with a variety of CD19 positive cancer cell lines, assessing direct cytotoxicity as well as IFN-γ production (Fig. 4 A). As expected, the HLA class I-deficient lymphoblastoid 721.221 cell line was killed efficiently by NK cells but not by T cells. For both effector cell types, redirection with the anti-CD19 CAR FMC63.28z significantly increased killing of CD19 + 721.221 with higher cytolytic activity in CAR NK cells than in CAR T cells, however CAR-mediated killing was significantly more pronounced in CAR T cells (Fig. 4 B, Fig. S5B). CD19 KO 721.221 target cells were not killed at higher rates by CAR NK cells than by untransduced NK cells, confirming specificity of the CAR (Fig. 4 C). A small but significant increase in killing of CD19 KO 721.221 cells by CAR T cells compared with untransduced T cells (Fig. 4 C) was most likely due to some remaining CD19 + cells within the CD19 KO population (Fig. S5A). Untransduced NK cells produced significantly more IFN-γ compared with untransduced T cells after coculture with 721.221 cells, however, at a range well below 500 pg/ml. In contrast, CAR T cells exhibited log-fold higher IFN-γ production in comparison to both untransduced effector cells and a more than sixfold increase relative to CAR NK cells (2687.8 pg/ml vs. 405.7 pg/ml; Fig. 4 D), demonstrating that CAR-mediated IFN-γ production was substantially higher in CAR T cells compared to CAR NK cells.
![essay and report similarities figure 4](https://media.springernature.com/lw685/springer-static/image/art%3A10.1186%2Fs40164-024-00522-6/MediaObjects/40164_2024_522_Fig4_HTML.png)
In vitro functionality of CAR T and CAR NK cells. Expanded cells were cocultured with different cancer cell lines at an effector to target (E:T) ratio of 5:1 for 4 h. Specific killing was assessed by flow cytometry using a membrane-impermeable DNA stain (TO-PRO-3) and PKH26 membrane-labeled target cells and IFN-γ production was measured by ELISA. A Schematic of the timeline. B , C Specific (left) and CAR-mediated (right) killing of CD19 + 721.221 ( B ) and CD19 KO 721.221 cells ( C ) by anti-CD19 CAR T, CAR NK cells or untransduced controls. D Overall (left) and CAR-mediated (right) IFN-γ production by anti-CD19 CAR T, CAR NK cells and untransduced controls after coculture with CD19 + 721.221 cells. (E, F) Specific (left) and CAR-mediated (right) killing of NALM6 ( E ) or Raji ( F ) cells by anti-CD19 CAR T, CAR NK cells and untransduced controls. G , H Overall (left) and CAR-mediated (right) IFN-γ production by anti-CD19 CAR T, CAR NK cells and untransduced controls after coculture with NALM6 ( G ) or Raji ( H ) cells. I Specific (left) and CAR-mediated (right) killing of LCL by autologous anti-CD19 CAR T cells, allogeneic anti-CD19 CAR NK cells and untransduced controls. J Overall (left) and CAR-mediated (right) IFN-γ production by autologous anti-CD19 CAR T cells, allogeneic anti-CD19 CAR NK cells and untransduced controls after coculture with LCL target cells. Data are from 1 to 3 independent experiments with n = 3–12 donors. Significance by mixed-effects analysis, RM one-way ANOVA with Tukey’s multiple comparisons, ordinary one-way ANOVA with Tukey’s multiple comparisons, two-tailed paired t-test or two-tailed unpaired t-test as appropriate; *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001. Symbols represent individual donors. Data shown as box and whiskers display the median as a line within the box; whiskers are shown from minimum to maximum data point
We observed a similar pattern of enhanced CAR-mediated cytotoxicity and IFN-γ production by CAR T cells relative to CAR NK cells for two additional cancer cell lines, NALM6, an acute lymphoblastic leukemia cell line, and Raji, a Burkitt lymphoma cell line (Fig. 4 E–H). Untransduced NK cells, being innate lymphocytes, killed NALM6 cells more efficiently compared with untransduced T cells, but CAR incorporation had a significantly more pronounced effect on increasing cytotoxicity in CAR T cells than in CAR NK cells relative to untransduced counterparts (Fig. 4 E, Fig. S5C). Similarly, while killing of Raji cells was higher with untransduced NK cells compared to untransduced T cells, CAR T cells exhibited significantly higher CAR-mediated killing of these target cells, an effect almost absent in CAR NK cells (Fig. 4 F, Fig. S5D). Untransduced T and NK cells produced IFN-γ at comparatively low levels after coculture with either target cell line (Fig. 4 G, H). As with 721.221 targets, redirection with the CAR led to drastically higher IFN-γ production by CAR T cells than by CAR NK cells upon coculture with both NALM6 and Raji cells (Fig. 4 G, H).
There is considerable interest in the use of allogeneic CAR NK cells as off-the-shelf products, whereas CAR T cells have so far only been approved as autologous products. In a corresponding translational approach, we generated autologous CAR T cells and allogeneic CAR NK cells and tested effector responses after CAR stimulation by short-term coculture. CD19 positive target cell lines, being either autologous or allogeneic to their respective effector cells, were produced in-house by transformation of primary human B cells with Epstein-Barr virus (EBV), yielding lymphoblastoid cell lines (LCL). While killing was low for both untransduced T and NK cells, autologous CAR T cells killed their targets much more efficiently than allogeneic CAR NK cells (42.9% vs. 15.2%) and CAR-mediated killing was significantly higher in autologous CAR T cells than in allogeneic CAR NK cells (Fig. 4 I, Fig. S5E). Again, we observed a similar pattern for IFN-γ with much higher production by autologous CAR T cells compared with allogeneic CAR NK cells (2484.9 pg/ml vs. 246.7 pg/ml; Fig. 4 J), confirming our previous findings. Thus, CAR NK cells were less efficient in producing IFN-γ in cocultures with various target cells, including freshly generated LCL. To test the maximum capacity for IFN-γ production, we stimulated effector cells with PMA and ionomycin. IFN-γ was produced at sixfold lower levels in both untransduced NK cells (795.5 pg/ml) and CAR NK cells (1143.2 pg/ml) in comparison to untransduced T cells (4998.7 pg/ml) and CAR T cells (6870.7 pg/ml), being slightly higher in both CAR T and CAR NK cells relative to the untransduced controls (Fig. S6A). IFN-γ itself did not affect the expansion of CAR NK cells, as neither blocking nor adding IFN-γ had an effect (Fig. S6B), although IFN-γ-R1 (CD119) was present on CAR NK cells, albeit at low but detectable levels (Fig. S6C).
Together, NK cells exhibited higher intrinsic cytolytic activity against various cancer cell lines compared with T cells, in line with their well-established innate capacity to eradicate tumor cells [ 34 ]. Consequently, the overall killing capacity of CAR NK cells was equal or better compared to CAR T cells against most cancer cell lines. In contrast, CAR-mediated killing by CAR T cells was significantly higher compared to CAR NK cells across target cells, including autologous CAR T cells, which were superior to allogeneic CAR NK cells in terms of killing freshly generated LCL tumor cells. Remarkably, CAR T cells produced far more IFN-γ than CAR NK cells in all target cell cocultures tested and also upon PMA and ionomycin stimulation, suggesting an overall reduced ability of CAR NK cells for IFN-γ production relative to CAR T cells.
In vitro functionality after long-term chronic and repetitive CAR stimulation
We next performed long-term single restimulation assays with IL-2 preactivated effector cells (Fig. 5 A). Both untransduced NK cells and CAR NK cells were highly dependent on IL-2 preactivation, as killing of the NK cell sensitive 721.221 cell line was greatly reduced and virtually absent in LCL without preactivation (Fig. S6D). We observed a similar effect for CAR T cells, especially with LCL as targets, but to a much smaller extent (Fig. S6D). Preactivated untransduced NK cells killed 721.221, NALM6 and Raji cells at a high level after restimulation, while no further increase in killing was obtained with CAR NK cells, thus CAR-mediated killing was minimal in CAR NK cells (Fig. 5 B–D). In contrast, cytolytic activity against allogeneic LCLs was significantly higher in CAR NK cells relative to untransduced NK cells (Fig. 5 E). CAR T cells efficiently killed target cells, albeit with lower cytolytic activity against 721.221 cells, but similar for NALM6 and Raji and even higher for LCL (Fig. 5 B–E). Notably, CAR-mediated killing by CAR T cells was uniformly higher compared to CAR NK cells in all four target cell lines tested (Fig. 5 B–E), analogous to acute stimulation (Fig. 4 ). After one round of restimulation, CAR T cells also consistently produced much higher amounts of IFN-γ than CAR NK cells, irrespective of the target cell line and almost exclusively through a CAR-mediated effect (Fig. 5 F–I).
![essay and report similarities figure 5](https://media.springernature.com/lw685/springer-static/image/art%3A10.1186%2Fs40164-024-00522-6/MediaObjects/40164_2024_522_Fig5_HTML.png)
In vitro functionality of CAR T and CAR NK cells after restimulation. Expanded cells were cocultured for 24 h with the indicated cancer cell lines in the presence of 100 U/ml IL-2 and restimulated once. Specific killing after the final 4-h target cell restimulation without IL-2 was assessed by flow cytometry using a membrane-impermeable DNA stain (TO-PRO-3) and PKH26 membrane-labeled target cells. IFN-γ production was measured by ELISA. A Schematic of the timeline for single restimulation experiments ( E effector cells. T target cells). B – E Specific (left) and CAR-mediated (right) killing after single restimulation of 721.221 cells ( B ), NALM6 cells ( C ) or Raji cells ( D ) by anti-CD19 CAR T, CAR NK cells and untransduced controls and of LCL ( E ) by autologous anti-CD19 CAR T cells, allogeneic anti-CD19 CAR NK cells and untransduced controls. (F-I) Overall (left) and CAR-mediated (right) IFN-γ production after single restimulation with 721.221 cells ( F ), NALM6 cells ( G ) or Raji cells ( H ) by anti-CD19 CAR T, CAR NK cells and untransduced controls and with LCL ( I ) by autologous anti-CD19 CAR T cells, allogeneic anti-CD19 CAR NK cells and untransduced controls. Data are from 1 to 2 independent experiments with n = 2–10 donors. Significance by mixed-effects analysis, RM one-way ANOVA with Tukey’s multiple comparisons, ordinary one-way ANOVA with Tukey’s multiple comparisons, two-tailed paired t-test or two-tailed unpaired t-test as appropriate; *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001. Symbols represent individual donors. Data shown as box and whiskers display the median as a line within the box; whiskers are shown from minimum to maximum data point
To model chronic and recurrent stimulation, effector cells were repetitively exposed to LCL over a period of 7 days (Fig. 6 A). Whereas killing of 721.221, NALM6 and Raji cells by untransduced NK and CAR NK cells was sustained in the final rechallenge, CAR T cells displayed decreased killing of NALM6 cells with significantly higher CAR-mediated killing of target cells compared to CAR NK cells against 721.221 cells only (Fig. 6 B–D). Nevertheless, CAR-mediated killing of these cancer cell lines by CAR NK cells was virtually absent (Fig. 6 B–D). Interestingly, cytotoxicity was maintained at high levels in both autologous CAR T cells and allogeneic CAR NK cells, again with superior killing by CAR T cells (Fig. 6 E). While IFN-γ production was reduced across all target cells compared to acute stimulation and single restimulation experiments, CAR T cells continued to produce more in most conditions (Fig. 6 F–I). Thus, our data indicated functional exhaustion of CAR T cells in their ability to produce IFN-γ and, to some extent, their capacity for redirected killing, which progressively decreased from single restimulation to repetitive stimulation relative to acute CAR stimulation. IFN-γ production remained mostly unchanged at very low levels in CAR NK cells after chronic CAR stimulation. On the other hand, we did not detect exhaustion in terms of cytotoxicity in neither untransduced NK cells nor CAR NK cells in our in vitro models.
![essay and report similarities figure 6](https://media.springernature.com/lw685/springer-static/image/art%3A10.1186%2Fs40164-024-00522-6/MediaObjects/40164_2024_522_Fig6_HTML.png)
In vitro functionality of CAR T and CAR NK cells after repetitive, long-term restimulation. Expanded cells were repetitively cocultured for one week with the indicated cancer cell lines in the presence of 100 U/ml IL-2. Specific killing after the final 4-h target cell restimulation without IL-2 was assessed by flow cytometry using a membrane-impermeable DNA stain (TO-PRO-3) and PKH26 membrane-labeled target cells. IFN-γ production was measured by ELISA. A Schematic of the timeline for multiple restimulations experiments. (B-E) Specific (left) and CAR-mediated (right) killing after repetitive restimulation of 721.221 cells ( B ), NALM6 cells ( C ) or Raji cells ( D ) by anti-CD19 CAR T, CAR NK cells and untransduced controls and of LCL ( E ) by autologous anti-CD19 CAR T cells, allogeneic anti-CD19 CAR NK cells and untransduced controls. (F-I) Overall (left) and CAR-mediated (right) IFN-γ production after final 4-h coculture following repetitive restimulation with 721.221 cells ( F ), NALM6 cells ( G ) or Raji cells ( H ) by anti-CD19 CAR T, CAR NK cells and untransduced controls and with LCL ( I ) by autologous anti-CD19 CAR T cells, allogeneic anti-CD19 CAR NK cells and untransduced controls. Data are from 1 to 2 independent experiments with n = 3–9 donors. Significance by mixed-effects analysis, RM one-way ANOVA with Tukey’s multiple comparisons, ordinary one-way ANOVA with Tukey’s multiple comparisons, two-tailed paired t-test or two-tailed unpaired t-test as appropriate; *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001. Symbols represent individual donors. Data shown as box and whiskers display the median as a line within the box; whiskers are shown from minimum to maximum data point
Anticancer activity of CAR T and CAR NK cells in vivo
Next, to explore anticancer activity of anti-CD19 autologous CAR T and allogeneic CAR NK cells in vivo, we implanted lymphoblastoid tumor cells (LCL) subcutaneously into NSG mice [ 35 , 36 , 37 ], modeling human B cell lymphoma therapy with either autologous CAR T cells [ 38 ] or allogeneic CAR NK cells [ 11 ]. Mice were treated with adoptive cell transfer (ACT) three days after tumor engraftment and injection of IL-2 to support transferred cells. Transferred effector were either autologous (T cell products) or allogeneic (NK cell products) to the tumor (Fig. 7 A). After ACT of 4 × 10 6 effector cells, we detected autologous CAR T cells in most of the mice at day 10 (Fig. S7A) and all of the mice at day 17 (Fig. S7B) but we were unable to detect allogeneic CAR NK cells at any of these time points. Autologous CAR T cells, but not allogeneic CAR NK cells, reduced tumor growth to a significant but small extent (Fig. 7 B and Fig. S8A).
![essay and report similarities figure 7](https://media.springernature.com/lw685/springer-static/image/art%3A10.1186%2Fs40164-024-00522-6/MediaObjects/40164_2024_522_Fig7_HTML.png)
Tumor control in vivo by autologous CAR T cells but not allogeneic CAR NK cells. A Schematic outline of in vivo experiments. NSG mice were subcutaneously injected in the flank with 2 × 10 6 lymphoblastoid tumor cells (in-house generated LCL) and three days after tumor engraftment, mice were treated with ACT of 4 × 10 6 or 10 × 10 6 effector cells, being either autologous (T cells products) or allogeneic (NK cell products) to the tumor. Transferred cells were supported by supplementation of IL-2 (1 × 10 5 IU every second day, i.p.). Tumor growth was monitored with caliper measurements. B Tumor growth over time in individual mice treated with 4 × 10 6 autologous CAR T cells, 4 × 10 6 allogeneic CAR NK cells or untreated controls (left), tumor size at the endpoint (middle) and tumor size relative to average tumor size in untreated controls (right). C Tumor growth over time in individual mice treated with ACT of 10 × 10 6 effector cells over time (left), tumor size at the endpoint (middle) and tumor size relative to average tumor size in untreated controls (right). D Representative dot plots of transferred effector cells identified by CD45 and CD3 or CD56 coexpression (left) and quantification of human cells in peripheral blood at day 14 after tumor engraftment in mice treated with ACT of 10 × 10 6 effector cells (right). E Flow cytometric analysis of tumors showing percentage of CD19 + tumor cells, CD3 + T cells or CD56 + NK cells within the human CD45 + compartment in mice receiving ACT of 10 × 10 6 effector cells as indicated. Data are from 2 independent experiments with n = 15–24 mice (n = 4–5 mice per group). Significance by ordinary one-way ANOVA with Tukey’s multiple comparisons; *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001. Data shown as box and whiskers display the median as a line within the box; whiskers are shown from minimum to maximum data point
To establish whether increasing the number of transferred autologous CAR T or allogeneic CAR NK cells would increase persistence and tumor control, we adoptively transferred 10 × 10 6 effector cells. Tumor control was markedly improved in mice treated with autologous CAR T cells, while no effect of allogeneic CAR NK cells was observed, despite the increased number of transferred cells (Fig. 7 C and Fig. S8B). Nonetheless, transferred cells could be detected in all of the mice at day 14 after tumor engraftment (Fig. 7 D). At the end of experiments, three weeks after tumor engraftment, we harvested blood, spleen and tumors to investigate phenotype of transferred cells in more detail. Autologous CAR T cells showed high levels of the exhaustion markers CD39, PD-1 and Tim-3 in blood, spleen and tumor while control T cells exhibited high expression of these markers only in tumors (Fig. S8C). Activation, as assessed by HLA-DR expression, was higher in CAR T cells than in controls in blood and spleen but similar in tumors. Interestingly, tumor infiltrating CAR T cells had reduced Ki-67 intensity, indicating lower proliferation of CAR T cells relative to controls (Fig. S8D). The percentage of progenitor-like TCF-1 + cells was lower in blood in CAR T cells and was further decreased in tumors in both CAR T cells and controls in comparison to blood and spleen (Fig. S8E). Consistent with an effector-like phenotype of tumor infiltrating cells with increased tissue retention, CAR T cells and controls exhibited increased levels of the residency markers CD69 and CD103 (Fig. S8F) and increased levels of the cytolytic effector molecules perforin and granzyme B compared with blood and spleen (Fig. S8G). Overall, these data suggested acquisition of a more activated and exhausted-like T cell state after ACT as compared to the infusion product (Fig. 2 D), with exhaustion being more pronounced in CAR T cells across compartments. Transferred NK cells displayed increased CD56 intensity in both CAR NK cells and controls in tumors compared with blood and spleen, indicating activation, while percentage of CD16 and CD57 expression in tumors were decreased (Fig. S9A), thus resembling the infusion product phenotype (Fig. 3 D). NKG2A was expressed higher in tumor infiltrating NK cells than in spleen and blood, whereas KIR expression was decreased (Fig. S9B). In line with increased tissue retention, percentages of the residency markers CD69 and CD49a were distinctly higher in tumor infiltrating CAR NK cells and control NK cells (Fig. S9C). Finally, while both transferred NK cell populations displayed high expression Eomes, the transcription factor T-bet was significantly higher relative to controls in tumor infiltrating CAR NK cells, suggesting terminal NK cell maturation [ 39 ] (Fig. S9D). Notably, analysis of tumor cell composition indicated eradication of CD19 + tumor cells after transfer of CAR T cells, consistent with tumor control as measured by size (Fig. 7 C), but not after ACT of any of the other effector cells, including CAR NK cells, as CD19 + cells were distinctly depleted only in tumors of mice receiving CAR T cells (Fig. 7 E). Together, these data demonstrated efficient tumor control by autologous CAR T cells but not by allogeneic CAR NK cells.
Lastly, we used the NALM6 xenograft model [ 40 ] to compare anticancer activity of CAR T cells and CAR NK cells in a systemic leukemia model in vivo. This model is known to be highly responsive to anti-CD19 CAR T cells [ 41 ], thus allowing us to use lower numbers of CAR T cells. Because we did not observe tumor control in the LCL lymphoma model with the same number of low- or high-dose CAR NK cells as with CAR T cells, we transferred a higher number of CAR NK cells (10 × 10 6 ) compared to CAR T cells (2 × 10 6 ) (Fig. S10A). In this setting, tumor control was equal in NALM6-bearing mice transferred with CAR T cells and CAR NK cells, while transfer of neither untransduced T nor untransduced NK cells had an effect, also ruling out prominent intrinsic antitumor activity of NK cells (Fig. S10B, C). Adoptively transferred NK cell products (CAR NK cells and untransduced NK cells) were detected in all mice in peripheral blood and at higher abundance than CAR T cells (Fig. S10D). These findings indicate that CAR NK cells display anticancer activity in vivo but require higher doses than CAR T cells.
Using CAR T and CAR NK cells generated under identical manufacturing processes with a benchmark CAR construct [ 24 ] used in an approved CAR T cell product (axi-cel), we demonstrated that CD19 directed human CAR T and CAR NK cells displayed similar cytotoxicity against established CD19 + cancer cell lines in vitro in models of both acute and chronic stimulation. However, in modeling a situation of potential future clinical use, allogeneic CAR NK cells exhibited significantly reduced cytotoxicity relative to autologous CAR T cells in vitro against recently established CD19 + lymphoblastoid cell lines. The cytotoxic response of CAR NK cells against established CD19 + HLA class-I deficient and proficient cancer cell lines might thus be due in relevant part to innate NK cell recognition and not be CAR mediated. Indeed, untransduced NK cells displayed better killing of these cancer cell lines relative to untransduced T cells, hence CAR-mediated cytotoxicity was consistently much higher in CAR T cells than in CAR NK cells. Furthermore, we found that CAR NK cells had a distinctly reduced capacity to produce IFN-γ after coculture with established cancer cell lines as well as in allogeneic settings, but also intrinsically after stimulation with PMA and ionomycin. This is likely to put CAR NK cells at a disadvantage, as the secretion of IFN-γ may be essential for the anticancer activity of CAR cells in regulating adhesion to cancer cells [ 42 ], recruitment of endogenous immune cells [ 43 ] and antigen spreading [ 44 ]. These mechanisms of IFN-γ mediated enhancement of anticancer efficacy or potential loss thereof during adoptive transfer of CAR NK cells mostly rely on interactions with endogenous immune cells, which are difficult to model in vitro or in immunodeficient xenograft models. After chronic repetitive stimulation, CAR T cells secreted less IFN-γ, indicative of exhaustion. However, cytotoxicity was maintained in both autologous CAR T cells and, at reduced level, in allogeneic CAR NK cells. While this is more challenging with CAR T cells, repeated administration of allogeneic CAR NK cells may therefore be reasonable given that they did not exhibit exhaustion with respect to their cytotoxicity. Within this context, we found comparable tumor control by CAR NK cells when using high cell doses as by CAR T cells in a systemic leukemia model. Critically, however, autologous CAR T cells outperformed allogeneic CAR NK cells in our comparative assessment of anticancer activity in vivo in the lymphoma model. We observed reduced persistence of allogeneic CAR NK cells relative to autologous CAR T cells after transfer of lower cell doses, but not after administration of higher cell numbers. Still, these higher cell numbers of CAR NK cells were not sufficient to control tumors in the lymphoma model as did CAR T cells but similarly delayed tumor growth in a systemtic leukemia model.
In a direct head-to-head comparison of CD19 directed human NK and T cells, we report markedly reduced IFN-γ production, significantly lower CAR-mediated killing by CAR NK cells, and superior anticancer activity of autologous CAR T cells compared to allogeneic CAR NK cells in vivo. Approaches that increase cytotoxicity and IFN-γ production of CAR NK cells might thus be needed to potentiate their anticancer activity.
Data availability
All data supporting the findings of this study are available within the paper and its Supplementary Information.
Elsallab M, Levine BL, Wayne AS, Abou-El-Enein M. CAR T-cell product performance in haematological malignancies before and after marketing authorisation. Lancet Oncol. 2020;21:e104–16.
Article CAS PubMed PubMed Central Google Scholar
Westin JR, et al. Efficacy and safety of CD19-directed CAR-T cell therapies in patients with relapsed/refractory aggressive B-cell lymphomas: observations from the JULIET, ZUMA-1, and transcend trials. Am J Hematol. 2021;96:1295–312.
Article PubMed PubMed Central Google Scholar
Cappell KM, Kochenderfer JN. Long-term outcomes following CAR T cell therapy: what we know so far. Nat Rev Clin Oncol. 2023;20:359–71.
Bach PB. National coverage analysis of CAR-T therapies—policy, evidence, and Payment. N Engl J Med. 2018;379:1396–8.
Article PubMed Google Scholar
Jain T, et al. Use of chimeric antigen receptor T cell therapy in clinical practice for relapsed/refractory aggressive B cell non-hodgkin lymphoma: an expert panel opinion from the american society for transplantation and cellular therapy. Biol Blood Marrow Transplant. 2019;25:2305–21.
Article CAS PubMed Google Scholar
Morris EC, Neelapu SS, Giavridis T, Sadelain M. Cytokine release syndrome and associated neurotoxicity in cancer immunotherapy. Nat Rev Immunol. 2022;22:85–96.
Qasim W. Genome-edited allogeneic donor ‘universal’ chimeric antigen receptor T cells. Blood. 2023;141:835–45.
Berrien-Elliott MM, Jacobs MT, Fehniger TA. Allogeneic natural killer cell therapy. Blood. 2023;141:856–68.
Zhang Y, Zhou W, Yang J, Yang J, Wang W. Chimeric antigen receptor engineered natural killer cells for cancer therapy. Exp Hematol Oncol. 2023;12:70.
Liu E, et al. Use of CAR-transduced natural killer cells in CD19-positive lymphoid tumors. N Engl J Med. 2020;382:545–53.
Marin D, et al. Safety, efficacy and determinants of response of allogeneic CD19-specific CAR-NK cells in CD19+ B cell tumors: a phase 1/2 trial. Nat Med. 2024;30:772–84.
Portillo AL, et al. Expanded human NK cells armed with CAR uncouple potent anti-tumor activity from off-tumor toxicity against solid tumors. Iscience. 2021;24:102619.
Neelapu SS, et al. Axicabtagene ciloleucel CAR T-cell therapy in refractory large B-cell lymphoma. N Engl J Med. 2017;377:2531–44.
Westin JR, et al. Survival with axicabtagene ciloleucel in large B-cell lymphoma. N Engl J Med. 2023;389:148–57.
Kaulfuss M, et al. The NK cell checkpoint NKG2A maintains expansion capacity of human NK cells. Sci Rep. 2023;13:10555.
Chijioke O, et al. Human natural killer cells prevent infectious mononucleosis features by targeting lytic epstein-barr virus infection. Cell Rep. 2013;5:1489–98.
Concordet J-P, Haeussler M. CRISPOR: intuitive guide selection for CRISPR/Cas9 genome editing experiments and screens. Nucleic Acids Res. 2018;46:W242–5.
Roth TL, et al. Reprogramming human T cell function and specificity with non-viral genome targeting. Nature. 2018;559:405–9.
Ferlazzo G. Isolation and analysis of human natural killer cell subsets. Methods Mol Biol. 2008;415:197–213.
CAS PubMed Google Scholar
Denman CJ, et al. Membrane-bound IL-21 promotes sustained ex vivo proliferation of human natural killer cells. PLoS ONE. 2012;7: e30264.
Ciurea SO, et al. Phase 1 clinical trial using mbIL21 ex vivo-expanded donor-derived NK cells after haploidentical transplantation. Blood. 2017;130:1857–68.
Ciurea SO, et al. Decrease post-transplant relapse using donor-derived expanded NK-cells. Leukemia. 2022;36:155–64.
Girard-Gagnepain A, et al. Baboon envelope pseudotyped LVs outperform VSV-G-LVs for gene transfer into early-cytokine-stimulated and resting HSCs. Blood. 2014;124:1221–31.
Kochenderfer JN, et al. Construction and preclinical evaluation of an anti-CD19 chimeric antigen receptor. J Immunother. 2009;32:689–702.
Sekine T, et al. TOX is expressed by exhausted and polyfunctional human effector memory CD8+ T cells. Sci Immunol. 2020. https://doi.org/10.1126/sciimmunol.aba7918 .
Zhao X, Shan Q, Xue H-H. TCF1 in T cell immunity: a broadened frontier. Nat Rev Immunol. 2022;22:147–57.
Abou-El-Enein M, et al. Scalable manufacturing of CAR T cells for cancer immunotherapy. Blood Cancer Discov. 2021;2:408–22.
Ayala Ceja M, Khericha M, Harris CM, Puig-Saus C, Chen YY. CAR-T cell manufacturing: major process parameters and next-generation strategies. J Exp Med. 2024;221: e20230903.
Van Acker HH, Capsomidis A, Smits EL, Van Tendeloo VF. CD56 in the immune system: more than a marker for cytotoxicity? Front Immunol. 2017;8:892.
Long EO, Kim HS, Liu D, Peterson ME, Rajagopalan S. Controlling natural killer cell responses: integration of signals for activation and inhibition. Annu Rev Immunol. 2013;31:227–58.
Liu LL, et al. Critical role of CD2 Co-stimulation in adaptive natural killer cell responses revealed in NKG2C-deficient humans. Cell Rep. 2016;15:1088–99.
Wong P, et al. T-BET and EOMES sustain mature human NK cell identity and antitumor function. J Clin Invest. 2023;133: e162530.
Abel AM, Yang C, Thakar MS, Malarkannan S. Natural killer cells: development, maturation, and clinical utilization. Front Immunol. 2018;9:1869.
Wolf NK, Kissiov DU, Raulet DH. Roles of natural killer cells in immunity to cancer, and applications to immunotherapy. Nat Rev Immunol. 2023;23:90–105.
Koehne G, et al. Serial in vivo imaging of the targeted migration of human HSV-TK-transduced antigen-specific lymphocytes. Nat Biotechnol. 2003;21:405–13.
Hiwarkar P, et al. Cord blood T cells mediate enhanced antitumor effects compared with adult peripheral blood T cells. Blood. 2015;126:2882–91.
Dasari V, et al. Lymph node targeted multi-epitope subunit vaccine promotes effective immunity to EBV in HLA-expressing mice. Nat Commun. 2023;14:4371.
Neelapu SS, et al. Five-year follow-up of ZUMA-1 supports the curative potential of axicabtagene ciloleucel in refractory large B-cell lymphoma. Blood. 2023;141:2307–15.
CAS PubMed PubMed Central Google Scholar
Kiekens L, et al. T-BET and EOMES accelerate and enhance functional differentiation of human natural killer cells. Front Immunol. 2021;12: 732511.
Brentjens RJ, et al. Genetically targeted T cells eradicate systemic acute lymphoblastic leukemia xenografts. Clin Cancer Res. 2007;13:5426–35.
Zhao Z, et al. Structural design of engineered costimulation determines tumor rejection kinetics and persistence of CAR T cells. Cancer Cell. 2015;28:415–28.
Larson RC, et al. CAR T cell killing requires the IFNγR pathway in solid but not liquid tumours. Nature. 2022;604:563–70.
Alizadeh D, et al. IFNγ is critical for CAR T cell-mediated myeloid activation and induction of endogenous immunity. Cancer Discov. 2021;11:2248–65.
Ma L, et al. Vaccine-boosted CAR T crosstalk with host immunity to reject tumors with antigen heterogeneity. Cell. 2023;186:3148-3165.e20.
Download references
Acknowledgements
This work was supported by Cancer Research Switzerland (KFS-4371-02-2018 and KFS-5292-02-2021) to O. C. and a research fellowship from the German Research Foundation to M.K. (project number 415801544). The study also benefitted from the CRPP ImmunoCure and HMZ Immuno-TargET of the University of Zürich. Figures of experimental timelines were created with a licensed version of BioRender.
Author information
Authors and affiliations.
Cellular Immunotherapy, Institute of Experimental Immunology, University of Zürich, Winterthurerstrasse 190, 8057, Zurich, Switzerland
Lukas Egli, Meike Kaulfuss, Juliane Mietz, Arianna Picozzi & Obinna Chijioke
International Center for Infectiology, research team Enveloped Viruses, Vectors and Innate Responses, Institut national de la Santé et de la recherche médicale, unité 1111, Unité mixte de recherche 5308, Centre national de la recherche scientifique, École Normale Supérieure de Lyon, Université Claude Bernard Lyon 1, University of Lyon, Lyon, France
Els Verhoeyen
Université Côte d’Azur, Institut National de La Santé Et de La Recherche Médicale, Centre Méditerranéen de Médecine Moléculaire, Nice, France
Viral Immunobiology, Institute of Experimental Immunology, University of Zürich, Zurich, Switzerland
Christian Münz
Institute of Medical Genetics and Pathology, University Hospital Basel, Basel, Switzerland
Obinna Chijioke
You can also search for this author in PubMed Google Scholar
Contributions
L.E., M.K. and O.C. conceptualized, designed and evaluated experiments. L.E., M.K., J.M. and A.P. performed experiments. E.V. provided reagents. C.M. provided input. O.C. supervised the study. L.E. and O.C. wrote the manuscript. All authors edited and approved the final version of the manuscript.
Corresponding author
Correspondence to Obinna Chijioke .
Ethics declarations
Competing interests.
The authors declare no potential competing of interests.
Additional information
Publisher's note.
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Supplementary Information
40164_2024_522_moesm1_esm.pdf.
Supplementary Material 1: Figure S1: (A) Gating strategy for sorting of T and NK cells from PBMCs of healthy donors. (B) Purity of T and NK cells after 3 weeks of expansion and gating for further analysis of T and NK cells. Figure S2: Phenotype by flow cytometry of non-expanded T cells (baseline), expanded untransduced T cells and expanded CAR T cells purified from PBMC after expansion with K562mbIL21 and IL-2 supplementation for 3 weeks. (A) Representative contour plots showing marker expression in expanded untransduced T cells. (B) Bar graphs showing individual marker expression across T cell populations. (C) Bar graph showing individual expression of NK cell markers in T cells at baseline, expanded untransduced human T cells and expanded CAR T cells. Data from 1-3 experiments with n=3-9 donors. Significance by 2way ANOVA with Tukey’s multiple comparisons; *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001. Symbols represent individual donors. Figure S3: (A) Timeline of the generation and expansion of anti-CD19 CAR T cells using CD3/CD28 costimulation. (B) Transduction rates of T cells after CD3/CD28 costimulation. (C) Flow cytometric analysis of CD4 and CD8 expression and percentages of CD4 + and CD8 + T cells within freshly isolated CD3 + T cells (baseline), untransduced T cells and CAR T cells, expanded with CD3/CD28 costimulation (D) Flow cytometric analysis of T cell differentiation and percentages of naïve (T N , CD45RA + CD62L + ), central memory (T CM , CD45RA - CD62L + ), effector memory (T EM , CD45RA - CD62L - ) and T EMRA (CD45RA + CD62L - ) cells within T cell populations before and after expansion with CD3/CD28 costimulation. (E) Bar graphs showing individual marker expression comparing CAR T cells generated with feeder-based expansion (CAR T) or with CD3/CD28 costimulation (CAR T (CD3/CD28 stim )). (F) CAR T cells were cocultured with the indicated target cell lines at an effector to target ratio of 5:1 for 4 hours. Specific killing was assessed by flow cytometry using a membrane-impermeable DNA stain (TO-PRO-3) and PKH26 membrane-labeled target cells. Specific killing of NALM6 (left) and autologous LCL (right). Data for T cells expanded with K562mbIL21 feeder cells are from 1-3 experiments with n=7-9 donors and data for CD3/CD28 costimulation are from 1 experiment with n=3 donors. Significance by 2way ANOVA with Tukey’s multiple comparisons or two-tailed unpaired t-test as appropriate; *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001. Symbols represent individual donors. Data shown as box and whiskers display the median as a line within the box; whiskers are shown from minimum to maximum data point. Figure S4: (A) Representative contour plots showing marker expression in expanded untransduced NK cells. (B) Bar graphs showing individual marker expression across NK cell populations. Data are from 3 independent experiments with n=5-9 donors. Significance by 2way ANOVA with Tukey’s multiple comparisons; *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001. Symbols represent individual donors. Figure S5: (A) Flow cytometry plots of CD19 expression before (left) and after (right) CRISPR/Cas9-mediated knockout of CD19 in 721.221 cells (B-E) Expanded effector cells were cocultured with the indicated cancer cell lines at the indicated effector to target (E:T) ratios for 4 hours. Specific killing was assessed by flow cytometry using a membrane-impermeable DNA stain (TO-PRO-3) and PKH26 membrane-labeled target cells. Data are from 1 experiment with n=2-3 donors. Significance by 2way ANOVA with Tukey’s multiple comparisons (only CAR T vs. CAR NK is shown); **p<0.01. Figure S6: (A) IFN-γ production of effector cells following stimulation with PMA and ionomycin. (B) Fold expansion of untransduced NK and CAR NK cells after 9 days in either the presence of an IFN-γ blocking antibody (clone B27) or recombinant 10 ng/ml IFN-γ. (C) Expression of IFN-γ-R1 (CD119) on CAR NK cells as assessed by flow cytometry. (D) Specific killing of 721.221 cells (left) and LCL (right) after single restimulation by effector cells in the absence of IL-2. Data are from 1 to 2 independent experiments with n=3-6 donors. Significance by RM one-way ANOVA with Tukey’s multiple comparisons; *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001. Symbols represent individual donors. Data shown as box and whiskers display the median as a line within the box; whiskers are shown from minimum to maximum data point. Figure S7:Tumor-bearing NSG mice were adoptively transferred with 4 x 10 6 autologous CAR T or 4 x 10 6 allogeneic CAR NK cells at day 3 after tumor engraftment and presence of transferred cells in peripheral blood was assessed by flow cytometry on day 10 (A) and day 17 (B) after tumor engraftment. 5 mice per group, plots showing data from individual mice. Figure S8: Blood, spleen and tumors were harvested from NSG mice treated with 10 x 10 6 effector cells (autologous CAR T cells, autologous control T cells, allogeneic CAR NK cells or allogeneic control NK cells) at the end of the experiment and single-cell suspensions analyzed by flow cytometry. (A, B) Tumor growth curves of individual mice treated or not with ACT of 4 x 10 6 of the indicated effector cells (relates to Figure 7B) (A) and treated or not with ACT of 10 x 10 6 of the indicated effector cells (relates to Figure 7C) (B). Percentage or mean fluorescence intensity (MFI) of indicated markers within T cells (C-G). 5 mice per group. Significance by two-tailed unpaired t-test; *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001. Data shown as box and whiskers display the median as a line within the box; whiskers are shown from minimum to maximum data point. Figure S9: Blood, spleen and tumors were harvested from NSG mice treated with 10x10 6 effector cells (autologous CAR T cells, autologous control T cells, allogeneic CAR NK cells or allogeneic control NK cells) at the end of the experiment and single-cell suspensions analyzed by flow cytometry. (A-D) Percentage or mean fluorescence intensity (MFI) of indicated markers. 5 mice per group. Significance by two-tailed unpaired t-test; *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001. Data shown as box and whiskers display the median as a line within the box; whiskers are shown from minimum to maximum data point. Figure S10: (A) Schematic outline of in vivo NALM6 experiment. 5 x 10 5 NALM6-Luc cells were injected intravenously into NSG mice and four days after tumor engraftment, mice were treated with ACT of 2 x 10 6 (T and CAR T) or 10 x 10 6 (NK and CAR NK) effector cells from 2 donors each. Transferred cells were supported by supplementation of IL-2 (1 x 10 5 IU every second day, i.p.). Tumor growth was monitored weekly by IVIS. (B) Bioluminescence measurements of tumor-bearing NSG mice at indicated time points to assess in vivo functionality of adoptively transferred cells. (C) Tumor growth over time measured by IVIS (left) and overall survival (right). (D) Presence of adoptively transferred cells in peripheral blood was assessed by flow cytometry on day 8 after tumor engraftment, plots show individual mice. 4-6 mice per group. Significance by log-rank Mantel–Cox (survival) followed by Bonferroni correction. *p<0.05, **p<0.01.
Rights and permissions
Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/ . The Creative Commons Public Domain Dedication waiver ( http://creativecommons.org/publicdomain/zero/1.0/ ) applies to the data made available in this article, unless otherwise stated in a credit line to the data.
Reprints and permissions
About this article
Cite this article.
Egli, L., Kaulfuss, M., Mietz, J. et al. CAR T cells outperform CAR NK cells in CAR-mediated effector functions in head-to-head comparison. Exp Hematol Oncol 13 , 51 (2024). https://doi.org/10.1186/s40164-024-00522-6
Download citation
Received : 29 October 2023
Accepted : 08 May 2024
Published : 14 May 2024
DOI : https://doi.org/10.1186/s40164-024-00522-6
Share this article
Anyone you share the following link with will be able to read this content:
Sorry, a shareable link is not currently available for this article.
Provided by the Springer Nature SharedIt content-sharing initiative
- Chimeric antigen receptor
- Adoptive cell therapy
- Human T cells
- Human NK cells
- Cytotoxicity
Experimental Hematology & Oncology
ISSN: 2162-3619
- Submission enquiries: [email protected]
- Share full article
Advertisement
Supported by
Guest Essay
China’s Dead-End Economy Is Bad News for Everyone
![essay and report similarities essay and report similarities](https://static01.nyt.com/images/2024/05/12/autossell/11yang-art-promo/11yang-art-promo-square640.png)
By Anne Stevenson-Yang
Ms. Stevenson-Yang is a co-founder of J Capital Research and the author of “Wild Ride: A Short History of the Opening and Closing of the Chinese Economy.”
On separate visits to Beijing last month, Secretary of State Antony Blinken and Treasury Secretary Janet Yellen bore a common message : Chinese manufacturing overcapacity is flooding global markets with cheap Chinese exports, distorting world trade and leaving American businesses and workers struggling to compete.
Not surprisingly, China’s leaders did not like what they heard, and they didn’t budge. They can’t. Years of erratic and irresponsible policies, excessive Communist Party control and undelivered promises of reform have created a dead-end Chinese economy of weak domestic consumer demand and slowing growth. The only way that China’s leaders can see to pull themselves out of this hole is to fall back on pumping out exports.
That means a number of things are likely to happen, none of them good. The tide of Chinese exports will continue, tensions with the United States and other trading partners will grow, China’s people will become increasingly unhappy with their gloomy economic prospects and anxious Communist Party leaders will respond with more repression.
The root of the problem is the Communist Party’s excessive control of the economy, but that’s not going to change. It is baked into China’s political system and has only worsened during President Xi Jinping’s decade in power. New strategies for fixing the economy always rely on counterproductive mandates set by the government: Create new companies, build more industrial capacity. The strategy that most economists actually recommend to drive growth — freeing up the private sector and empowering Chinese consumers to spend more — would mean overhauling the way the government works, and that is unacceptable.
The party had a golden opportunity to change in 1989, when the Tiananmen Square protests revealed that the economic reforms that had begun a decade earlier had given rise to a growing private sector and a desire for new freedoms. But to liberalize government institutions in response would have undermined the party’s power. Instead, China’s leaders chose to shoot the protesters, further tighten party control and get hooked on government investment to fuel the economy.
For a long time, no one minded. When economic or social threats reared their heads, like global financial crises in 1997 and 2007, Chinese authorities poured money into industry and the real estate sector to pacify the people. The investment-driven growth felt good, but it was much more than the country could digest and left China’s landscape scarred with empty cities and industrial parks, unfinished bridges to nowhere, abandoned highways and amusement parks, and airports with few flights.
The investment in industrial capacity also generated an explosion in exports as China captured industries previously dominated by foreign manufacturers — mobile phones, television sets, solar panels, lithium-ion batteries and electric vehicles. Much of the Chinese economic “miracle” was powered by American, European and Japanese companies that willingly transferred their technical know-how to their Chinese partners in exchange for what they thought would be access to a permanently growing China market. This decimated manufacturing in the West, even as China protected its own markets. But the West let it slide: The cheap products emanating from China kept U.S. inflation at bay for a generation, and the West clung to the hope that China’s economic expansion would eventually lead to a political liberalization that never came.
To raise money for the government investment binge, Beijing allowed local authorities to collateralize land — all of which is ultimately owned or controlled by the state — and borrow money against it. This was like a drug: Local governments borrowed like crazy, but with no real plan for paying the money back. Now many are so deep in debt that they have been forced to cut basic services like heating, health care for senior citizens and bus routes . Teachers aren’t being paid on time, and salaries for civil servants have been lowered in recent years. Millions of people all over China are paying mortgages on apartments that may never be finished . Start-ups are folding , and few people, it seems, can find jobs.
To boost employment, the party over the past couple of years has been telling local governments to push the establishment of new private businesses, with predictable consequences: In one county in northern China, a village secretary eager to comply with Beijing’s wishes reportedly asked relatives and friends to open fake companies. One villager opened three tofu shops in a week; another person applied for 20 new business licenses.
When mandates like that fail to create jobs, the party monkeys with the employment numbers. When monthly government data revealed last year that 21 percent of Chinese youth in urban areas were unemployed, authorities stopped publishing the figures. It resumed early this year, but with a new methodology for defining unemployment . Presto! The number dropped to 15 percent.
But Mr. Xi’s policy options are dwindling.
With the real estate market imploding, the government can no longer risk goosing the property sector. It has begun touting a revival in domestic consumption , but many Chinese are merely hunkering down and hoarding assets such as gold against an uncertain future. So the government is again falling back on manufacturing, pouring money into industrial capacity in hopes of pushing out more products to keep the economy going. With domestic demand anemic, many of those products have to be exported.
But the era when China was able to take over whole industries without foreign pushback is over. Many countries are now taking steps to protect their markets from Chinese-made goods. Under U.S. pressure, Mexico’s government last month reportedly decided it would not award subsidies to Chinese electric vehicle makers seeking to manufacture in Mexico for export to the U.S. market; the European Union is considering action to prevent Chinese electric vehicles from swamping its market; and the Biden administration has moved to encourage semiconductor manufacturing in the United States and limit Chinese access to chip technologies, and has promised more actions to thwart China.
China won’t be able to innovate its way out of this. Its economic model still largely focuses on cheaply replicating existing technologies, not on the long-term research that results in industry-leading commercial breakthroughs. All that leaves is manufacturing in volume.
China’s leaders will face rising economic pressure to lower the value of the renminbi, which will make Chinese-made goods even cheaper in U.S. dollar terms, further boosting export volume and upsetting trading partners even more. But a devaluation will also make imports of foreign products and raw materials more expensive, squeezing Chinese consumers and businesses while encouraging wealthier people to get their money out of China. The government can’t turn to economic stimulus measures to revive growth — pouring more renminbi into the economy would risk crushing the currency’s value.
All of this means that the “reform and opening” era, which has transformed China and captivated the world since it began in the late 1970s, has ended with a whimper.
Mao Zedong once said that in an uncertain world, the Chinese must “Dig tunnels deep, store grain everywhere and never seek hegemony.” That sort of siege mentality is coming back.
Anne Stevenson-Yang ( @doumenzi ) is a co-founder and the research director of J Capital Research, a stock analysis firm. She spent 25 years in China as an entrepreneur, analyst and trade advocate.
The Times is committed to publishing a diversity of letters to the editor. We’d like to hear what you think about this or any of our articles. Here are some tips . And here’s our email: [email protected] .
Follow The New York Times Opinion section on Facebook , Instagram , TikTok , WhatsApp , X and Threads .
- All Solutions
- Audience measurement
- Media planning
- Marketing optimization
- Content metadata
- Nielsen One
- All Insights
- Case Studies
- Perspectives
- Data Center
- The Gauge TM – U.S.
- Top 10 – U.S.
- Top Trends – Denmark
- Top Trends – Germany
- Women’s World Cup
- Men’s World Cup
- News Center
Client Login
News Center > Corporate
Nielsen launches the media distributor gauge, first convergent tv comparison of its kind, 8 minute read | may 2024, building on industry-defining the gauge™, new insight shows total cross-platform view of audience engagement by media company., disney tops april’s media distributor gauge, claiming 11.5% of time spent watching tv..
NEW YORK – May 14, 2024 – Nielsen, a global leader in audience measurement, data and analytics, today launched The Media Distributor Gauge , a first of its kind, cross-platform view of total TV consumption across broadcast, cable and streaming, aggregated and ranked by media company. The new insight removes the siloes of traditional television versus streaming, and puts all content distributors on a level playing field to allow for additional perspective of TV viewing today. This new view is being released in addition to The Gauge™ report for April 2024, which is detailed below.
“With more programs available across platforms, it’s vital for creators, advertisers and the industry at large to understand what and where audiences are watching,” said Karthik Rao, CEO of Nielsen. “The Media Distributor Gauge is a perfect complement to the The Gauge and serves as the first convergent TV comparison of its kind. Together, these reports paint the most complete picture of TV viewing today, which is critical as we head into the Upfront.”
This new insight is created by mapping all the various national media distributors — including broadcast and cable networks and streaming services — up to their parent company. Nielsen calculates the total minutes viewed on the TV screen for each network’s services and aggregates those totals based on initial distributor mapping, ultimately arriving at a share of total TV usage for each parent company. The minimum reporting threshold for a parent company in The Media Distributor Gauge is a 1.0% share of TV. Similar to the fluctuation of monthly TV usage tracked in The Gauge, rankings within the media company view will also demonstrate shifts that correlate with the seasonality of TV viewing.
![essay and report similarities](https://www.nielsen.com/wp-content/uploads/sites/2/2024/05/media-gauge-APR-2024-PR.png?w=1024)
In Nielsen’s first report of The Media Distributor Gauge, 14 media companies achieved a 1.0% or greater share of total TV usage. As the top performer in April, Disney accounted for 11.5% of TV viewing, with 42% of its share attributable to viewing on Disney+ and Hulu. YouTube was the No. 2 overall company with a 9.6% share of TV in April, followed by NBCUniversal at 8.9%, Paramount at 8.8%, and Warner Bros. Discovery at 8.1% to round out the top five. Netflix was sixth with 7.6% of TV, and the second-highest streaming distributor reported.
![essay and report similarities](https://www.nielsen.com/wp-content/uploads/sites/2/2024/05/APR-2024@.png?w=1024)
The Gauge™: Nielsen’s monthly snapshot of total TV usage in April 2024
April saw record-breaking viewership: the NCAA women’s basketball tournament coverage on broadcast and cable, and Amazon Prime Video’s new original series Fallout, which set a new high watermark for the streamer as its most successful program to date. From an overall usage perspective, time spent watching TV was fairly flat both month-over-month (down 2%) and on an annual basis (down 0.6%).
![essay and report similarities](https://www.nielsen.com/wp-content/uploads/sites/2/2024/05/the-gauge-APR-2024-PR.png?w=1024)
Across the primary viewing categories:
- Cable was the only category in The Gauge to escape decline as it achieved a second consecutive monthly increase in share, moving up from 28.3% of TV in March to 29.1% (+0.8 pt.) in April. Cable sports viewing increased 28% vs. March, bolstered by NCAA basketball tournament coverage, NBA playoffs and the NFL draft. Women’s NCAA basketball finals and semifinals coverage accounted for four of the top six cable telecasts in April, and the WNBA draft notched 17th. While cable viewing increased about 1% on a monthly basis, a year-over-year comparison shows viewing has declined 8.2% vs. April 2023, and its share has lost 2.4 points.
- Broadcast viewing was down 3% in April, which equated to a 22.2% share of TV (-0.3 pt.). Similar to cable, women’s sports were the bright spot in the broadcast category this month. The NCAA women’s basketball championship game drew 17.6 million viewers on ABC (plus over 1 million more tuned in on ESPN), making it the top broadcast telecast in April by a large margin. The drama genre accounted for 29% of broadcast viewing, driven by Tracker, NCIS and Young Sheldon on CBS, and Chicago Fire and Chicago Med on NBC.
- Streaming viewership declined 1.9% from March to April, prompting the category to lose just 0.1 share point to account for 38.4% of total television. Amazon Prime Video saw the largest increase among streaming services this month with a 12% monthly increase for 3.2% of TV (+0.4 pt.). Prime Video’s April success was driven by its original series Fallout, which also topped all streaming titles this month with over 7 billion viewing minutes. YouTube, despite a 3% monthly decline in viewing, added a 15th month to its streak as the top streaming platform in The Gauge with a 9.6% share of TV in April.
About The Gauge™
The Gauge™ is Nielsen’s monthly snapshot of total broadcast, cable and streaming consumption that occurs through a television screen. It was expanded in the April 2024 report to include The Media Distributor Gauge, which reflects total viewing by media distributor across these categories. Underpinned by Nielsen’s National TV measurement and Streaming Platform Ratings services, in addition to complimentary insights from its Streaming Content Ratings service, The Gauge provides the industry with a holistic look at the various content audiences are watching. The latest edition of The Gauge is always available at nielsen.com/thegauge .
About Nielsen
Nielsen shapes the world’s media and content as a global leader in audience measurement, data and analytics. Through our understanding of people and their behaviors across all channels and platforms, we empower our clients with independent and actionable intelligence so they can connect and engage with their audiences—now and into the future. Nielsen operates around the world in more than 55 countries. Learn more at www.nielsen.com and connect with us on social media ( Twitter/X , LinkedIn , Facebook and Instagram ).
Press Contact
Lauren Pabst [email protected]
![essay and report similarities](https://www.nielsen.com/wp-content/uploads/sites/2/2021/10/bg2-1.jpeg)
Find the right solution for your business
In an ever-changing world, we’re here to help you stay ahead of what’s to come with the tools to measure, connect with, and engage your audiences.
How can we help?
![](http://ortec.site/777/templates/cheerup1/res/banner1.gif)
IMAGES
VIDEO
COMMENTS
Conclusion. After exploring the differences between essays and reports, it is clear that these two forms of writing serve different purposes and require different approaches. Essays are typically more subjective and allow for more creativity, while reports are more objective and require a focus on facts and data.
An essay is written on the basis of subjective analysis of theories and past research, by other people and own ideas, on the concerned subject. As against, a report is objective and factual, which is based on past research, as well as present data and findings. An essay talks about general facts and events along with the writer's personal ...
Essays usually focus on analysing or evaluating theories, past research by other people, and ideas. They may include applying theory to practice if you are in a practice-based field. A report usually contains tables, charts and diagrams. Essays don't usually include tables, charts, or diagrams.
This handout will help you first to determine whether a particular assignment is asking for comparison/contrast and then to generate a list of similarities and differences, decide which similarities and differences to focus on, and organize your paper so that it will be clear and effective. It will also explain how you can (and why you should ...
Making effective comparisons. As the name suggests, comparing and contrasting is about identifying both similarities and differences. You might focus on contrasting quite different subjects or comparing subjects with a lot in common—but there must be some grounds for comparison in the first place. For example, you might contrast French ...
Essay conclusions reflect the writer's personal opinions and tend to be optimistic, lacking recommendations for future actions. Reports provide impartial conclusions, potentially including expert opinions and recommendations for further research and improvement. Similarities between Essay and Report. Both are written documents.
The main differences between a report and an essay. Reports are divided into many sections whereas essays have three main sections divided into paragraphs. Reports include an abstract, essays do not. Reports can use bullet points, essays do not. Reports can use subheadings for each of the sections, it is rare for essays to have subheadings.
An essay tends to focus on concepts, issues and/or theory. The focus of a report is more concrete: the report looks at an issue in a real-world context. Essays, especially business essays, often use real-world examples to illustrate a concept or theory but a conceptual, or abstract, idea is the focus. Business reports often focus on a case ...
WHAT'S THE DIFFERENE ETWEEN REPORTS AND ESSAYS? A report is a piece of informative writing that describes a set of actions and analyses any results in response to a specific brief. A quick definition might be: ^This is what I did and this is what it means. You may also have assignments which are not called reports but which are still pieces of informative writing; for
A comparative essay asks that you compare at least two (possibly more) items. These items will differ depending on the assignment. You might be asked to compare. Although the assignment may say "compare," the assumption is that you will consider both the similarities and differences; in other words, you will compare and contrast.
This is because comparing identifies the likeness between two subjects, items, or categories, while contrasting recognizes disparities between them. When you compare things, you represent them regarding their similarity, but when you contrast things, you define them in reference to their differences. As a result, if you are asked to discuss the ...
Use Clear Transitions. Transitions are important in compare and contrast essays, where you will be moving frequently between different topics or perspectives. Examples of transitions and phrases for comparisons: as well, similar to, consistent with, likewise, too. Examples of transitions and phrases for contrasts: on the other hand, however ...
Essay and report writing is an area that confuses many people. Despite having some similarities, they both are written in different styles. Both Essays and Reports must be written in a formal academic style while carefully checking grammar, spelling, and presentations. There are some common features in essay and report writing as both start ...
3 years ago. Hi Rediet A report and an essay format are similar as both include an introduction, main body, and conclusion sections. Reports further include methodology and analysis in the main body and have a fixed structure. Essays as well as research papers are writings. Essays as well as research papers have multiple sentences and paragraphs.
4.1 Comparison Essay Outline Example. 5 Tips to Write a Compare and Contrast Essay. 5.1 Comparison Essay Format. 6 Bringing It All Together. As we navigate our lives, we can't help but notice the elements in our environment, whether it's the latest car, a fashion trend, or even some experiences. Think about your favorite Mexican restaurant ...
An essay is a focused piece of writing designed to inform or persuade. There are many different types of essay, but they are often defined in four categories: argumentative, expository, narrative, and descriptive essays. Argumentative and expository essays are focused on conveying information and making clear points, while narrative and ...
Key Differences Between Essays and Reports. The following are key differences between essays and reports: Purpose: Essays aim to persuade, inform, or entertain, while reports primarily aim to inform, analyze, or propose solutions. Structure: Essays consist of an introduction, body paragraphs, and a conclusion, whereas reports consist of an ...
Difference Between Essays and Reports in a Table. Reports. Essays. Reports are written with a specific purpose and audience in mind. Essays are written to demonstrate that the author fully understands the research question and can answer it with research. All reports start with a purpose but also include details of events/results of research.
4.1: Introduction to Comparison and Contrast Essay. The key to a good compare-and-contrast essay is to choose two or more subjects that connect in a meaningful way. Comparison and contrast is simply telling how two things are alike or different. The compare-and-contrast essay starts with a thesis that clearly states the two subjects that are to ...
The Compare/Contrast Essay - Similarities and Differences Come to Light. Writing a Compare/Contrast Essay Think of the Compare/Contrast essay as a bridge between both the Personal Essay and the Issues (Research) Essay. To begin, we often compare and contrast things in our everyday lives—what gas station to go to, what to major in, which job ...
To compare is to examine how things are similar, while to contrast is to see how they differ. A compare and contrast essay therefore looks at the similarities of two or more objects, and the differences. This essay type is common at university, where lecturers frequently test your understanding by asking you to compare and contrast two theories, two methods, two historical periods, two ...
Final Tips. In conclusion, writing a comparison essay involves selecting two or more subjects with significant similarities and differences, developing a strong thesis statement, and organizing your essay using either a point-by-point or block structure. By providing detailed analysis, addressing counterarguments, and using credible evidence ...
Similarities and Differences Reports & Essay - Free download as Word Doc (.doc / .docx), PDF File (.pdf), Text File (.txt) or read online for free. Similarities and Differences Reports & Essay
In 2022, 31-year-old Maggie Perkins quit her eight-year teaching job and got a job at Costco. She doesn't regret the decision, and she's never been happier. Here's a look at a day in the life ...
Conference Committee Report Housing Finance and Policy 5/14/2024 1:08 PM Change Items HOUSE HOUSE SENATE SENATE CONFERENCE CONFERENCE CONFERENCE CONFERENCE FY24-25 FY26-27 FY24-25 FY26-27 FY24 FY25 FY24-25 FY26-27 ... Comparison to February 2024 Forecast Page 1 of 1. Author: Katrina Heimark Created Date:
CAR NK cells as vehicles for engineered "off-the-shelf" cellular cancer immunotherapy have attracted significant interest. Nonetheless, a comprehensive comparative assessment of the anticancer activity of CAR T cells and CAR NK cells carrying approved benchmark anti-CD19 CAR constructs is missing. Here, we report a direct head-to-head comparison of CD19-directed human T and NK cells.
Adaptive, Externalizing, and Internalizing Behavior of Children with Prenatal Alcohol Exposure: A Comparison of Three Parent-Report Questionnaires Chloe M. Sobolewski a Center for Behavioral Teratology, Department of Psychology, San Diego State University, San Diego, CA, USA View further author information
Instead, China's leaders chose to shoot the protesters, further tighten party control and get hooked on government investment to fuel the economy. For a long time, no one minded. When economic ...
Follow. Dublin, May 14, 2024 (GLOBE NEWSWIRE) -- The "Automotive Ultrasonic Radar and OEMs' Parking Route Research Report, 2024" report has been added to ResearchAndMarkets.com's offering. Over ...
Disney tops April's Media Distributor Gauge, claiming 11.5% of time spent watching TV. NEW YORK - May 14, 2024 - Nielsen, a global leader in audience measurement, data and analytics, today launched The Media Distributor Gauge, a first of its kind, cross-platform view of total TV consumption across broadcast, cable and streaming, aggregated and ranked by media company.